Description :
From Genome Similarity Track
Location :
Scaffold_145:3423- 6367
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_145-snap-gene-0.20WD-repeat protein
Pytap_DAOMBR444maker-pag1_scaffold_145-snap-gene-0.21Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_145-fgenesh-gene-0.10Set5p

Sequence
2944 bases(100 bases per row)
CATGGCCGTAGGAGACGCTTCGCTCTGGCATCTAGCTGAGAGCATCACGTGCCACGCGTGGAACAAGGACCGTACCAAGGTCGCGATCTGCCCCAACTCg
AATGAGATCTGGGTCTACTCGGGATGCCAAAACGCCGACGCCTCGCAGTGGCGCAAAGAGGCCGTGCTCACGGAACACGACATGGTTGTCAGTGGCCTTG
ATTGGtCGCCAGTCAACGaCATGCTTGtGTCGTGCTCGCACGATCGTAGCGCGTTCGTCTGGCAGTACGAAGCCAAGTTCCGACAGTGGAAGCCGACGCT
CGTGGTGCTCCGAATTGCCCGCGCTGCCATCAATGTGAAGTGGAGCCCAAACGGTACGTATTTATATTATTGGAGTGGGGAGAAGGAAGGAGGTGCTGAA
GTGGCGTGAGTAGGCCAGAAGTTCGCAGTGACTAGTGGCGCCAAATGCGTTGCTGTGTGCACGTACCAGGCCGCAGAGAACTGGTGGGTCAGCAAGATCA
TCAAGAAGCACAAGTCTACGTACGTCTGTCTTTCATGCATTCACCATTTGTGCTTTtCCTAACCGAAGCATCCTTGCTTGCAGAGTCACGGACCTGGCAT
GGCACCCAAACAGTCAGCTGCTTGTGACTGGCAGCACGGACCTCAAGTGCCGCGTGTTCTCCGCGTATATCGCCGATGTTGACGGTGCTGCGgACGCTGG
TCCATTCCCACAGCTCGCTCCATTTGGTGAGCCAATGGCTGAGTTCGACAACGCGAGCGCTTGGGTTAACGCCGTCGCGTGGTCACCCAAGGGCGATCGT
CTCGCGTTCGCTGGACACGGATCCTCTGTCCACTTCGTGCACTTTGGCGCACCAGGCCAGTACCCAACCATTCAATCGGTCCGTTTCCAGCAGTTGCCAC
TCAACAAGATCATGTTCCTGTCGAACGACGCGCTTGTTGGTGCTGGATATGATTTCAACGTGCTCTTGTTTGTCACCGATGGCAATGGCTTCTGGTCACT
GAGTGAACTGCTTGACAAGAAACCTGCCGAGTCTGCAAtCAAGCGTGACTCGGGTAGCTTCAATGCCGGTATGCAAACGTCGGTTTGAATTCGATGGAGT
GATGGTATCCGCTGATGCATAAATGACCtCAGCACGTAGCATGTGGGCGAGCAAGGTCTCGCGTGGTCAGTCGTCTGATGCCACGCAGAATGACAAGGGC
GCGCTCTGGACGAAGCACGAAAGCACGATCACCGACATGCATGTGTACTCGCACACGGCCACGGGTGGTGTGTCCGCCTTCACAACCTCGGGTGAGGTGT
AGTCTTGGATGGAATaGCTCAGCTCAATCATGCTAACATTCTATTGCGTATTGTTGCAGCTCTCGATGGCCGCATTGTGCTCTGGCAACTCCAGAGTTTG
AACGTGCAGATGGCCAAGCTGCGTCTGTAAGTAGAGAACCCTTCCTGCATCTGCGACTGGGAGCAGATGATATCGTGAAGAAACGAGGAGATCGATCGAT
CCTAACTACGACTCTATTCCAATCTCCATTTTGATTTACGCAAGTGCTCTGCGGAGAGTCTGCTTCATGTCTATTCGTACAGACGCTTTATTCTGCGGTA
GTCCTGTCGGTACTGATTCTCGACGAACGACGCCTGTCGGAAGTCCTTCCACTCCGGGAATTCGTCCAAAAGCACTTTCGGGTCCAGCGACAGCAGCAAT
TGAATCCCCTGGCTGACGTCATTCAAAGTGCGCGCCAGGTCGATGTGATCGTCATTCAAGTACATCTTCTGCAGCTCAAGCAGCTCGTAGCTGCTGCGAA
GGAAGAGAATTGCATACTCCCGCACGTCCTGGCTTGGTCTTGACTTGAGAATCTCATCACAGCAATCAGCCACAAGCTTATGGATTCGGATGAGGACCAC
GTGGTCATGAGCCACGATTTCCAACGCGTCCGACAGAGCCTCTAACGCAATCGAAAGCACCTGTGCACCGTCTCCGGTcgACTTGAGCAGCTCCTCAGCT
GACGCCACAACCTTCTCAACCTCCTCAATaTCAATCACTGGCATGTCCGCGCTGCTTTCTGTGGATTGTGGCTTCGGCAAAAtGCTGTCGCCGCGCACAC
ATAGAGCACATGTGCACACAAACCcGAACTGTTCTCGTAGGTTCTTCAGGCGCTTTCCGCGGCTTTGTTCACGTGGGTACAGATACGAGATGCTCAaCGG
CTCGCCCTTTCgAATCTTCTTGGCAACGCGGACTTCCGAGACACCAGCATCACTCTCTTCGGGAGTGAACTTGACGCAGTTTGGATTACAGTCGTGATTG
AACATCGCATTAAAGAGGAACACGCCACTATCGAACGCGTTGCACTGCATGCCGAACACATTCTGGAGTAGCTGGTCATGCGTAACGCCAAGGGAAGCAA
AGCGCTGACGAAGCTGTtCGAGTGGTTCGCCATACTTCTCCCGTCCGGCCTGGAGCACTTCTTCTGGGAGGTCTTCCAGACGTTGTGGGTGCAAGTGTGC
GAGATGCGCCATCACATCCTGGTAGTCTGTGCGGTCGAGGATCGCTTCCATTGTCGCAATGAAGAAGCGAGGATCCGACTGGTCCACATCGCTTGGCCAT
GGCACaTACACCTTCTCCATGAGCACAAGCGTACCGGGCTCAAGGTCTTCTGTCGCCACGTAGCCGCGTCCGCCACCAATGTGTGCGCACTCACTCACGA
GCTCGATGGGCCCCACAAACTTGGGACGCACATCTTCCCACGCCGGATAGAGCGCCCTCGTGGATGACACACGTTGCGACGACGACGACAGTGGAGCTGT
TGGGGCGGCGAGCTTAaGCTGCTCAACGAGCTTCACCACGGGCGCCGCGTGATTTTGCAGCGGTGCTGGCGGCGCCACGAaCGACTGCTCTTCTTCGTCG
CTGTCGTCATCAAAGAGCCCGAACGCTGCCTGTACTGAGTCACT