Description :
From Genome Similarity Track
Location :
Scaffold_217:3423- 5186
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_217-fgenesh-gene-0.1Copper-transporting ATPase

Sequence
1763 bases(100 bases per row)
TTCTTCGAGTCATCGACTATGCTGCTGACGTTTGTCACGCTAGGCAAGTACATGGAGTCGATGGCAAAGGGGAAAACCGCAGATGCGCTGTCGGAACTTG
CAAAGCTTCAGCCGAAGACCGCAATCCTGATCGTCGAGAGAGAGACTGACCGCGAGATCCCGATCGAGTTGGTGCAGCGTGGCGACTTGCTGCGTATTGC
GCCAGGCTCGAATGTGCCAACTGATGGCATTGTCAAGAGTGGAATGAGTTCGTGCGACGAGTCGATGCTCACGGGCGAGAGCATGCCGGTGGCCAAGGGT
CCTGGCGACTACGTGTTCGGTTCGACGATCAACCAGCAAGGTACGCTCGTGATCGAGTCGAGCTGCTTTGGCGGCGAGAGCAGCGCGCTGTCCCAGATCT
GTTCGCTCATCGAAGACGCGCAGCTGCACAAGGCGCCAATTCAGGCGTACGCTGATCGTCTCGCGTCCGTGTTCGCGCCATTCGTGCTGGCGGTGTCAAC
GCTGACATTCCTGTCGTGGTACATCTTGCTCGCGACCGACTCGATCCCGCACCAGTGGAAGCACGAACTCGGACTGAACCCGGAGGATGGCCACTCAAAT
GATCTCTTCATCTCGATCCTGTTTGCGATCTCAGTGGTCGTCATCGCCTGCCCGTGTGCGCTGGGTCTCGCGACTCCAACAGCCGTGATGGTTGGTTGTG
GCGTCGGCGCAAATAAGGGCATTCTCATCAAGGGCGGCCGTGCGCTCGAAATCGCCAAGCACGTGGACACGATTGTGTTTGACAAGACTGGTACGCTGAC
CGTCGGCCACCCGTCGGTCACGGACGTTGTGATCTCGGACCGCAGCATCACGCCGCGTGAAGTGCTCTACTACGGCGGCTCGCTGGAGTGTGTCAGTGAA
CACGTGCTGGGCAAGGCGATCGTCTTGACTGCGACCGAGCAAGAGAAACTGCAGCTGAAGGAGCCGACGCAGATTCACGTTGTCCCAGGCCGCGGTATCC
AAGGCGTCGTGCCACGCTGGAAGGAAAAAGTGTCTGGCGCCGAGGAAGTGAACGTCATGGTCGGCAACCCGGAGTACTGCGAAGAGAAGCGCATCGAGAT
TGGTGAAAAGATCCGCGAGCAAATGCATGAGCTCGAGATGGAGGGCAAGACTGTCGTGTGCGTCTGCATCGACGAGAAGCTGGTCGGTGTCATCGCGCTC
GCTGACACGCCTCGCCCGGAGTCGCAAGCAGTCGTGTCGTACCTCAAGTCGATGGGCCTCGACGTGTGGCTCATCACTGGTGACAACATCCGCACTGCGA
GCTCGATCGCGCGCAAGATGGGCATCGATCACGTGAAGGCGATCGCGCTCCCTGGTGAGAAGGCTGCACAGATCAAGGCACTGCAATCTCGCATCTCTCC
AATTACCAAGAAGCAGCGCGTGGTTTGTATGGTCGGTGATGGCATCAACGACGCTCCCGCTCTGGCGCAAGCCGACATCGGCATGGCGATTGGCGCGGGA
ACCCAGATCGCGAAGGCGGAAGCCGACATGATCCTGGTTAAGAGCAACTTGGCCGACGTCGTCGTCGCCCTCGACCTCGCGCGCGTCGTGTTTGCGCGCA
TTCGTCTTAACTTTTTCTTTTCGATCGCGTACAATTTCGTGGGCATCCCGCTTGCCGCAGGCATCTTCTTCCCGCTTCTACACTCGACGATGCCGCCAGC
GTGCGCTGGACTCGCGATGGCGTTCTCGTCCGTCTCGGTGGTGATCTCGTCGCTGTTGCTGAA