Description :
From Genome Similarity Track
Location :
contig_49:342284- 343680
Transcript NameFunction/comments
g8314.t1hypothetical protein

Sequence
1396 bases(100 bases per row)
TACCAGCTTGAAGGCCTTAACTGGCTTACGTTTTGCTGGTACAACCGTCGCAATTGTATTTTGGCCGACGAGATGGGTCTGGGTAAGACTGTTCAAGCAA
CTTCTATCCTCGAGCATTTGCGTCAACGAGAGTTTATCCGTGGACCGTTCCTAGTCGTAGCTCCGCTTGCTACGCTGGGTAACTGGAAGCGAGAGATTGA
AACGTGGACTTCGATGAACTGTGTTGTGTATCATGACTCAGAGGGAGGATCTGATATCCGTGCTTTCATTCGTGAACAAGAGTTCCACTTTGCGAGCGAA
GCTCATCGCAGACGCGGGATTTACAAGTTTAATGTTTTGGTCACATCATACCAGACGCTGATGATGGATGCAGAGTTTCTCGACTCCATTCATTGGCGGT
ACATTGTTATCGACGAAGCACACAAGCTGAAAAACCGCGAGGCCAAGCTTCTCCAGGTGCTCCATGGTTTTACTTGGGATTCATGTTTACTGATGACGGG
CACGCCGCTGCAGAATGGTGTGTTCGAGCTTTGGTGTTTACTGAACTTCATTGAGCCCGATAAATTCCCAAGTCAGCAGGAGTTTTACGATGAATTTGGC
GATCTAAATACTGCAGAACAAGTTGCGCAGCTGCATGAACAGTTGAGACCGTACATGCTGCGTCGTGTGAAGGAGGATGTTGAGAAAAGCATTCCGCCGA
AAGAAGAGACGATCGTCGACGTGGAACTCACGACGATGCAGAAGAAGTACTACCGCGCCATCTTTGAGCGGAATCGCCAGTTTTTGAACATGGGTGCTAC
GGCACTGTCGCCAATCTGGTCAACGTGGAAATGGAGCTACGCAAGTGCTGCAACCACCCGTTCTTAATTCGTGGAGTGGAGGATAAGGAGTGCGCCGCGT
TCGATGAGCAGCTTCGAATGAAGGTCTTAATCCAAGCAAGTGGGAAAACAGTGCTGCTCGACAAACTGCTGACAAAGTTCCGCCAGGAAAATAAGAAGGT
ACTTATCTTCTCGCAATTCAAGATTATGCTGGACATTATTGAAGATATGTGCCAGCTACGAGGCTACAGCATGGAGCGCCTGGATGGATCTGTTCGCGGA
AACTCTCGTCAGGCTGCAATTGATCGATTCAATAGCCCGGATTCAAACACGTTCGCGTTCCTGCTGAGTACCCGCGCCGGTGGTGTTGGTATCAACCTGA
TCGCGGCATCTGTAGTGATTTTGTTCGATAGCGACTGGAACCCTCAGAACGATCTTCAAGCCGTCGCGCGTTGCCACCGTATCGGGCAAACACAGTCGGT
GAACATTTACCGTTTGGTGACAAAGAAAACGTACGAAGCGCAAATGTTTGAGATTGCGTCGAAGAAGCTCGGAATGCACCATGCTGTGTTTGAGAC