Description :
From Genome Similarity Track
Location :
Scaffold_22:34220- 38948
Transcript NameFunction/comments
Phyin_T30-4PITG_11532Putative uncharacterized protein

Sequence
4728 bases(100 bases per row)
CCCGCAGTTCTTGCGTACTTTCCAGGACAATTTCTTGGCTAGAGCACACGAATTCTTCCGTGCGTATGCCGACCACTGCGTCGCGATAGTCTGGAGTGAC
ATGTTCTTGAGCACCTCATTTTTCGTGTTGAAGTCGAAGAAGCCACGAACGTAGCACTCCACTGTCGTGGGTGTCTTTTGGCGGTACAGTGCGCACACGG
ACATGTTTCCTCGCTCGATGCCGTGAGATCGCTCAAAGCTCGGGATGTCCGACAGAGCCACCGAGTGTGAAATGCTATATCCTACTCGTTCGCATCCACC
GACTTGAGTGATTCCTGTTGCATCGAGAGACACGTAGTCACGTCCCTCGTACAGTCGCCATTTTACGGCGACGGTACGGAACGGGTCGTGAAAGCTTGGC
TGGACGATCTCGTACAGCACCTTGCTGTCTCGAACGTTGTCCTTCGTGCAGGCAGACTGAATCCTCATGGCCTCGTCCGTGGTTGCCACTGCTCCATACA
TGACCTCTTCTAACTTCCCCTCGATAGTACCTAGTAGTAGAAGCTGCGGTGTTGCTGGACACTGTGCAGTAGACGTTAGGCGCTCATTGTAGATGCGCAC
ATTGCCTCGCCGTCGAACTTCACGCCAGCGTTGGGGATCGGCACGACCGTCTTTCGTCACCACGAGAGTATTATACTGGGAGATGTTATGTCCTGCGAGT
GTGTCTGCAAGGTGCTGCAGCATGTTACAGTCCTGCCTAGATATGGTAGGCTCTGGTAGCAAGTGCACGAGCCTCATGTTTGCCGTTGCTTTCTAAAATG
GCAATGCGCCGTGACGACTAAACTCTACGCGAGTTCGATGGTCTTCTTCAGTGTGCGTGCGAAGCAAACGGCGCATTTTTGAGAACAAATTATAGCTCAA
AGGCCAGTGGGTGCCTTAGAAGAGTCAGCAGACAAGAATAATAAGCTGTGAGTCGTCGGACCTCCGGACTTTACCACGGCGATACAGGAACGGAGCTTCA
GGAACATGCTGCTGACCAGCGCCAAGCTACTTAGGCCAGTGCTGGCGGGCACAATTAATTATAATAAGCATGGTATCGAACGATCGTCATGGTGCCCCAC
CGAACCTCGGTAACGCCTCAGCTGACCTTGCGGTGCGTCTGGACTCAACATGCACCCCGTAGGCAAGTACAATAGTAGCGGGACAAGCAGTCAGACTTTG
TTGCCTTTTCGAAAGTACTCACAGTTACTGGTGCTCGCTTCTGAGCACTTGTCAGGTTGGATCCGGAGTCAGGTGCTCCTGTTGCCCGCGGTGCTGGCCA
CGACATGCCCTGGATTTTGACTTAATGCATTCAGAGAGCTCAGACTGAGGTCTATCTTGGATATTACGCAATGAATCGCCAAAGCCACCGCACCGTACAG
TCAAAAGCTTGCGGAAACCTTGGAGGTTCGACACCCGACTGCTCCAACATACGTGTGCGTGATGCAACTTCCCACAAAAGAAAAAAAGAGTGCCAACTTC
ATCTGCGCATGCAAACGAAATGCTTAAAGCGCAGCGTCCGCTTTCCAACCCAATCCGTTGATGCATTAGCTTGCGTGCGCAAGAATATAAGTAGTCGGCA
CGTAAATGAATTAGACTGGTCGAGTGCTGTTGTGCGCCTCATCTATAAAGTATCACAAGATTACTTTCTCCTCCAAACAGCTATGCAGCTGACACCCACT
TAAGAGTCACTCATTCGAATTTAGGTGCTGCTGTTCATGAAGACCAACCTCACCAAATGTGGCGTTGTTCATGCTCCATGGCTTGACGCTTCCAATCCAT
CTATTGATACAAGCCCTCAGAGAACGTCCGATGTGCACGTCGCACAACAGCAAGCAGGGTTGGCAGAATCTGCAGTGCCCAGACATCAATTACTGCTCTG
CGCTGGTTTCGTGCACACGAGTGCTTCCTGTCATTTGGTCGGAACAGGTGCACAAGTTTGGCGCCAAATCAATTTGGCTGTACTGAATTGGCGCTGAATG
GGTCTAAAATGAGCGATGCACTAGGCGCGGAGTAGATCTTAGTGGCTTGCCACGATGGATACGTCTTTACAATTTTTAAGATGTTGACATATCACACGCA
TAAAGTGATTTCTCCGACTCCATGAGGCATGCGCATGGTAAATATGGCAGTTAGCAAGCTGAAAAATGGCAGGTTATTTCTAGGGCTCACTCACATAGTT
TCGACCAATAACAGTACGAGAATCGTATGGGTGTCGGCGTGGCCGATTAATGCATAAGTATATAAATTAATGAACATTTAAAGCAAATCTTGAATGCACA
GACTATTAACTGTATGTAAAAAAAGTCCTAACGTAAAATTTGTATAGGAAAAAAAAAGATCGGTGTATGTATATTTGTACAAGATCCTGCAATCGTACGT
ATTATGGACCCACATGCTTTATATCCAGCATGGTGAGTAGATTCCGTAAAGCCCGTACGCGACATCGAGCATGTGCAAATGGCTGTTTTATTGGGAATGA
ATCGTTTTTGACGGAGTCACGTACAGAACGGCTACGAAAGCAAATTTGTGTATTGCATCTGTTTGCTAAAAGCAAGTCATTTGGGCTATTACTTACGCAG
CTTCACTGCTTCCTACTCTTGGTGCTCTCTCTCTACCGCGTCGTCACCCCCAGTTTCCGTTGTCTCGTTCTGATCACTATCAGAATTCTCACCACCATCG
CTTCCCTCATTGCCGAGCCCTGCGGCTTCCTTTTCGTTCCCACCGTCCCCCTCCTCTTCACGACCCCCTTGTCCTCCCGTCCACTTTTTTGGTGGCACCC
TCAGCTGGATACCGCGGTCGTGGCGCGGCTGTGGGGCGCTCGCTTCCATTACGCCAAAGCTGGTGCCAAATGGAGAAGCAAGTCTGGTTGTTACTTGGGT
AGTATGCTTGGCGCACCTTGTCGCACAAGCAGACAATGCATTATACGTAAGTAGTAAGAACGATAGAGCATAGAAGCGTACCGTTTGAAACCTTTACTGC
AACCGAGACAGTAGAATCGCGTCACCTGCCGCTCTGTACTGCTTGTTTTCCGTATAGTACAGACCTTGCACTGCCGTTGATGCCGCTTTCGAATTCCATT
CACCTCCACCCACTCGTCGTCCATCTTTAGCTGGTGGGTGGACGGTGGAACGTTGCCAGGCAATGGTGTAGCTGGTCTCGGTGAGTACATCTTTGGACAC
ATACAGTATGAGTTAGCAATGTGAACAACCAGCAGAATAAGCTCCTTCCTTACCGTGTCTGCAAATTCGGCCGACCCCACTTGTAGTAGCTGGGCTTGCA
ACTGAGCGATGAAACCGGTTAGTTTGAATAGTCCCCACAGAATAGACGTTCCTCTCAAGAAGTTGTAGCGAGCTTTGTATCTATTAGATTAGATAAACCA
GACCCTTCTACGATGCGCCAATTGTCAATGATGCCCTTCCAGCGTTCGGCCTCCTCCTTACTTCGTGGAGGTCGCTGTCCTCCGCGACGGTTTGTTGTAG
AAGCTGCGCCAACTGCAGGTGTAGAACTTGATGAATCGCCAGTTTGAGGTGCATATAGTGACAGTTCATCATGTCGCTCTCGCTTGGGATCTCATCATCC
ACATCAGCTTTAAAATTATCCGTGTCCTCGTACCATTCAGCTGACCCAGTGTCTGAATCATCGTAATCCGAATCCAATGCACCACCATCATAGATGGCAT
CATCTTGTCGGGAATCTTGACGGGAATAGAGAGGAGGCGGGGTTGTGGGAACCGTAGTAGTGTGAATAACAGTAGATATATTCAGTGACCTTGCAAAATC
AACAGTAATATACAGCATGCTGTCAGAAATAAATCTCGCACATGCTTGATATCCATCATGTGACAGCGTACCTGGCAGCCGAAGATCGAGGTGGCGTTAG
CGATGAAGTCTGTTGCGCAGAGGAAACACCTTCCGATGTCGGTGCCTGCGTTGTGTTTGCTGCACATGGCGGAGATGGCGACGTGTTGCTATAGTCCTCA
TCGTCACCAACAAACGCATCGCTACAAACAATTACGAACATGAAGTGTGAGAAACACATCGTCCGCAAAACGCATAATCTCCTCACCTGACGGCTTCTGC
ATCAGCAGCAACGTGTGGGCTAGTTGACCGCGCAGATTTGTCAGCTCTTGAGCTCTTGGATGGTTCTTTTTCGCCGCCTTCTTCGGTGTTGTGATCCCTG
CCGCTGTCGCCATGTCAAACTCAGCGTCGATATTTCCTTGGTTGTCTGCCGTTCGCACGTAATCTTTGTCTCCGCTGTCACTCCCATCCTCATCAGTAGA
AGCAGTATCGACAGCAAGCGTTTCTGCATACAGTGCTGCGACTGGCTCCTTTCCTTTCAATCGCGGCGCTCTTGCCAGCAACTGTAATACCTCATTAGTG
CGCCCTTCTTCTGGTACGTAGCTGAAGCAGGAGGCTTGCGTGAAGCCACTGTCAACCTATGCCGCCTTCCTGTCGTTTCTGACGTAGGAGCCGAAACAAG
CGGTTCATCCGCAACTTCGTCGCCAAAGTCAGCATCGCGGGCACGCGTACCGTCGACATACGCACGGTGCTCTTCAAGCAGGCGGGCGCGGTCTGGGCCT
TCCTTTATCTCGAGACGACGCAGGAACGCCTCCGCTTCAGCGCGCGTGACGCGTCGGGGAGGCATCTTGGTCCCGCGTCTCGTTTGGAGAATGAATGGAT
GGCTCAGAGGCTTATCGTTTGAAGCACT