Description :
From Genome Similarity Track
Location :
Scaffold_158:3422- 4577
Transcript NameFunction/comments
Phymu_g5727hypothetical protein

Sequence
1155 bases(100 bases per row)
AGTATGTCCTGTGTGTCTATAGGAGCGGGGGCTTCGATGCGTCCAATGGCGAGGAGTCGCTTGTGCGCTACGATGTGCtcgtccaagaagcccaaCTTGT
GCAGAGGGTGCGGCGTACGAAGGACGCTTCCGGCTCATTTCGCGTTAGTGTTCCGACCCTTCAGAAAACCGAtaacggcgtcttcagcgcGGCGGCAGAA
CTCAAGGACTCTGTCTTTGTAGTCCTCCGCCTTGGCATCAAGCGCAAAGCCCTCAGCGAGGAATAGCTTCATGAacacgacgacgtggcgcgactccgac
ttcttctggcgATCTGATGAAGCTCACACTCGAGGCACACTGGTGCAGCACTCGTACCAAGCAGCGGAAAGGTTGGTGGCTTGTTTTTTTCCTGCGCTTG
GGCTTGTTTTCATTTTCTAACGTGGCGTCCTTTTGTTCGGCTTCTGGGTTTACATCTCGTTTGTTAGAAGTTAGCAGGTCACCCTCAACAACCGTCAGGC
GCGTGGAGAGGATTATGTTTGTCTCGATAAGCACTTAAATGACAGCACGAAGGTGGTCCAATCCTGAGCATGCTTGGTTACTTGCGTCTTGCGtttcttg
ttggtcttcAGCAGAGGGAGCAGCGTCGTTGTCCAAGCTAACAGCCTACGCAAGTACGTCAGCACGTTCGATCTCCGCCGCCGTCAAGCACTCCACGACA
CGCGTGACGATCGGAGAAACTGGCGCGAGATCCTTCGGCTGCGGGTAGTAGCGGATCAGATACGCCGTGAGTACATTGAGGACCTTGGTACTTCCATTTA
GGTTCGGTTGCCTCAGCCCTGCACAGGAACTGAAGAGGAGCGCTTGCAACCTTCCAAGCCTCTCCTGCGAGACGCGGTTAAGCTCTGCTATGTCGAGACC
TTTCGGCATCTCGTCCGAGCCCCAACTGCTCAAGACGCGAGCCACCTTCCTGTCCTCGCGAGCCGTGTTAGTGATGTAGGCGAAGGCCTTGTTGGTCTTC
GTCATATCCCACGCGCCGCGGTTAACAATCCACTGGGTTGCAAGGCGGTCGTCACCGTTGGCGTGCTGAGCCCCGCCGCGTCGGAAGGAGTGAGAGATCA
AGGCAACAGTTGCTCCAGCGGGTTCAACGACGCGCTTTAGCAACCTGTTTACGTa