Description :
From Genome Similarity Track
Location :
Scaffold_521:3422- 4431
Transcript NameFunction/comments
g14390.t1hypothetical protein

Sequence
1009 bases(100 bases per row)
CTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCCGATGCCACGACCGGTGGTAA
GGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGGAACCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGG
AAACATCGGTCACTATGTCCGCGAGTGCACAGCACCTGTGCACGCGGCGAAGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCTATCAAAAAACTAG
AGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCATAGAAGATCGCTGCCCCCAGTGAGAGTCAATC
TCACTGCAAGAAGCAAGATGACAAGCTGAACCTTGTCATCCTGAGGGTAAGCTCGAAGAGAGAGAGGTCTCTTCGTGCTCTAGTGGACTGTGGAGCATCG
AACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTG
TTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGATGAGCTTATCGTCCAGTTCCAGGACGATAAGTTCGATAT
GGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCGGCGCGACAGAGAGC
GATGGCCCTGTCGGCGCAGCACATGCACCACGTGATGCATGCGGCTCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCGGATCACCCCAAGCGAACAA
CAACGACTGCGAGAGTCGTTGGAAGAAAATGTGAGCCGAATCAGCAGGGCCTGATTCGAGAGGGTCTCGAAGCGTCCGGAGCGACGCGGTCGTGTCGACA
CACAATTTG