Description :
From Genome Similarity Track
Location :
Scaffold_187:34215- 36583
Sequence
2368 bases(100 bases per row)
CGGAGTAAACGCAAGAGCTAGTACGCCTGATCTGATCGCATCTTCGAAGTTGAATTTCATTATCACCCCATTGCCAATGCTAGAACATAAGGGTTTCTTT
CGTATATGCGTAGTGGCAAAGTCAAGCAGATCGGCTTACTCGTCGCGGAGGCAGCGTACGTCACCGATATTCGGTCAGCAGTGGTCTTTGCCGAGAATGA
ACGAGTTCTCAGAAGCTCATTAAATGGTGAGATTGTTCTTAATGAGAAGAATAGGATTGGGTGAAGTGCGTCTGCCTGATAGTCGCTCAAAACAATCTTA
TCTGTAATAATTTATTATCATTTGAGTATTTCTCCCGAACCAGTAATGTGCGAAAACGTACTCGTCACGAAGTCGACTTGAAATCAGGTTTGAAGTACTA
TTTCATAAAGAATTGGCCACTGCCTCGTGAACAAGTACTCGCGATCGATAGACTCTTTGTTTGCCCTTAGCAGCCGATCATGTGAGGGGATCAACTTCCC
TACATAGATGTCTGACCTTCTGCGTGCAAAAGCCACAAGAGGGTATCGGACAGGACATGCATTCAGCAAGTTGAATGCTGCAACTGTACGGGTTCAGAAG
CCGATATAAATGGAGTTCGTCACCATAGATGGTATGTCAAAGAGTATTATCTTTTCGTTCGTGTATCCGATGGATGGGATCTATCATATCCTAATGCTTG
AACAGGATATCCCGTATCCAACAGTAAGCACCTTGAGTGGTATGATCTAGGAATTGCTTGTGATGCGACAAGAAATAATAATATCCATGCCACATTCGAT
AGATGTGTGACAAATCTATTGATATCGGTGACAGACTTCGCACCTATGTCTTTGATGACGTATTCGTCCACAGATGAGATATGGACGGAGAGATGGATTT
GGAAGTCCATCGACTCCGTAAGGTTCTTGCAATTATGCGTGAGCATAATTTGAATGAAAGAAGTGTATAATTGCTGCTAGCAAAACCCCACTTCTACTGC
GCATAGTTAGTAAATACAGTATACGCCTGGATCCGTAGAAGATCAAGGCGATCACCGAATGGCCGGTACCCGTATATGTAAAGGGACTTCGATAGTTGCT
TAGATTAGTGGTGTATTTGCACAAATACTCGCGTAACCACGCCGATATGACCATATATATTTCTCGTTTACTTTAAAATGATGGAGACATGAGTATCAGA
GCTGAGTGTCAAGGCTCGATCGAGGGAATCCAGCGAATATTGATACAATCGCCGGTGTTGGTGATTGCAGACCAGGACAGACCATTTCATGTGTTCTGTA
ATGCCAGTGATTTTCCGATCGGATGTGCTTTAATGCAGTATGATAAAAACGGCGCGGAGTGTGTTGTCGGATATCAATCCTGTAAGCCTTAACCTGCTAA
ACGTAACTACGCCGTGCATGACAAGTAAACACCTTGCGATAAAGTACGCACTGGATCGGTTCAGGGTCTATATGTTAGGAGATATACACTTTATTACCTA
TGCGAAACATGCCCCATTACGTAAGGCCATCAATAGTTCACGCCTCCCGAAAAGAATGGAGCGGTGGATGTCTTCCTTCGCTAAGTATAATTTTTTCAAT
AAAGTACAAGCCAGTAGAATAAGCGTCTTTGATGGTGCAAAGTCGCGCTGGCTCGCGTTCGAACCGGCCGCGCAACCCCATAGTGAGACACCCACTGTTG
CGGTTTTGACTTCAACCATAATGTCTTCCCCCTTGATGTATGACACGCCAAATGCGTATATATGTGATCCAGCGATTGTGAATTTGATTAATCATCTCGT
AAATTCTTTCCGAAACACGTTAAAACATTTTTAGCGGTGTATCGGTCCTCCACGGACATATACCTTGTGTGTAACAGGTTGCTGATAAAATTCAGTCGTT
TCCGGCGACCCGCCTCGTGTCGTCGTAACCAAACCTAATTACTTGAGGTTGTGATCTTTTTCGAGTACCATAACGCCCCTGTAGATGGGTATGAGATGGG
TCTTTTACTGGCGAAACCAGTATCATTCCGTGCGCAAGTACGTTCGTTCTTGCGGAGTCTCCCAATGATAATATCTATCTATCTGTGCTCCGATGGGTAA
AATCAATCACTTCATGCTCCGTTGCAGTCTCTCCCAATTCCAGCGGACTGCTAAGAGTCTGTTTCACCGGGATTCGTTATCGGATTTCGCTCAGACTAAC
ACAAGGACACTGGTATTTTGTGTTCATTGATAAATTCATAAATATGGTACAACGTTTTGCTGTACTTAAATATTTAACAGCATCAGGTTGTGCACGTGTC
GTTTTTGACACGATCTTTCGCCTTGATGAAGTACCCCGTGAAATCGTGTCCGGTCGAGACCCGCGGTT