Description :
From Genome Similarity Track
Location :
contig_15:342113- 346887
Transcript NameFunction/comments
g3411.t1hypothetical protein

Sequence
4774 bases(100 bases per row)
CGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCAT
GCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCTACCTATGGTTCTGCTCGCTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGG
GCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGA
TTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGGCTGGCTCCACTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACA
GGGGTGACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAACTCGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAA
TGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGAT
ATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACACTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGA
GTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCC
ATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTAC
CAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGGCCAAACGAAGCTTCGCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGC
ACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGT
TCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCC
CAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGG
TTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTT
GGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACC
GGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAG
TGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGA
GGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCAC
CGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCA
AAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGC
CGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTAC
CTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTACACTGAGCGAGA
CGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGAC
CCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAA
CAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCG
GTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGT
GGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCG
ACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCAT
ACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCT
CTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGT
TCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCAT
GCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACC
CGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTG
ACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGA
ACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCT
GATCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCC
ACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGT
ACACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGACGAG
GAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTA
GCCGCGCTGTCCGAGAGTTCAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGCGGGCTACTTTATGATTAT
CTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTCGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGAACTGTCTACGGGGGTGA
TACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTGCGAGTGACCGACTATTGATTGCTACCAAGCCTCTGACGAGGCCTGGTTGCGACGT
CGGTTGACGAATGAACTGCCTGCGGGGATGATGCAGCCCGCAGTGACAGACGAAAACTGCTACTGCATCGAATTTGCATATTTACATGTGACGTGAACGA
TTTTCGAATGGAATTGGATTAAATGGAATTACTTGGAGCTCAAGAACTGCCGCTACGGATGACTACGGGCTTCGGACGGCACACTGGCAGCTTGAGGAAC
GAACGGAAAATTAGTGGACCAGACCGAAGCCTAGACCTCAGTGGTCGACGCGATGTTGGCCAAAACATCCAGTCGACCCTTGAGCGGCCGACGTGTTGGT
CGGTGCTGGACCGGGAGTGACCAGGCGAAGATTCGGAGACGTCTTCATTTTCCTCCTGGCTCGGTCGAGCACCACCGACAGAAGCTGGGCAGCCCATGGA
GCCGTCACCATAGCCGACGACAACGAGGATCCACCATCAACCCGACACCACCTCCGCCTGAGTCATCCCTCGGGCACGAACAGGCACTGGGGTTGCACGG
GCGAACGTGGTGTTGAACGGGTGGCTAGCCGGCGCGTCGACCCAACAATTGCGCCACGGCTGCCTGTCGTCCAA