Description :
From Genome Similarity Track
Location :
Scaffold_4:342107- 347455
Transcript NameFunction/comments
Phyin_T30-4PITG_03066Putative uncharacterized protein
Phyin_T30-4PITG_03067Adenylate kinase
Phyin_T30-4PITG_03068Hsp70-like protein
Phyin_T30-4PITG_03069Putative uncharacterized protein

Sequence
5348 bases(100 bases per row)
CATGCAAGCAGAAATTCGAGGTGTTTCTAAGCAATCCGTACCATTCGAGAGTGAGCAAACAGTGGACCGCCAAGTACATGCGTGAGGAACTGAGACCGTT
GATGTATCGCGTGAAGGAGATGCACCCGTCGCTCAGTCTGAACGCTTCGGTGAATGGCGTGTCTGGAGACTCTTTCTCGAAGATCGACATGTTCACGATG
AGCTGGCGTCCTCGAGACAAAGAAAGAGCTTTGTTCTGGAACTCCCCAGAGGACGAGTACTACTGCGAGAACGACCCTAGCGACCGCATGCCGCCGGCAC
TGATGAATCTCTTCAACGAAATACTCGGTTACGACGCGGAAGACGGTGACAGTGGCTCTTCTGGAGACGAAGATATTGACGACGTCGGGGAAGACGAGGA
CGGCGATTTCGGGGGATTCTTCCCCGTGTTGTAGTCTGAGAGATCAGCATTTTCAAACTTCATTATTATCATCGTCAATTGATAGTACTATTAATACTAC
CCGTTTGTAGTACATGTACGAAAAAACTTCGGACTTCACAAGTTGAAGCTAGTCTGCAAACATGCTTCGTAAGCGGGCGATGTACATGTACTCCCCGTTT
TAGTGACATACCGTATTGCGTTTTTATCGGTCTTGCTGACCGGCTCACAATCCAACTGACGTCAGGGACGTCAACCATGGCGTCAAAGTCTCTTAAGATC
ATGTTCCTTGGGGCCCCAGGCGCGGGCAAAGGCACGTACGCGTCCCGCATCGCTCCCATGCTGCAGATTCCGACCATCTCGACGGGGGATTTGGTGCGTC
ATGAGATCAAAACCAATACGCCGCTCGGAGACAAGATCAAGGCTTACAACAACAGCGGAGCACTCGTACCTGACCAGATTATCCTGGACATGATGGAGAC
GCGGCTGGCGCAGGACGACGCCAAGCGTGGATTTATCCTGGACGGATTTCCGCGTAATGTACCGCAAGCCGAGGCTTTCCAGCAGGTGACCAAGCTGGAC
CTGGTGATCAACATCGACCTGCCTCAGTGGATTCTCTCGGACAAGATCAGCGGCAGAAGGTCAGTAAGCGTTGAATGAGATTGGTATCTGTGGACAAAAC
TTAATTTTGTGCGGATGTGTGACTAGGGTGTGTACCAAGTGCGGCTCGGGCTACAACGTAGCCTTCATCAACCAGGGAGAGTACTACATGCCACCGCTAC
TGCCCAATGTGGAGGGTATCTGCGACTCATGTGGCTCGGCGTCACTGGTACAGCGTCGAGACGACTCTCCTGATACTGTGAAACAGAGACTGGCAGTGTA
TAACCAAGAGACGGCCCCATTGGTTGACTTTTACACCAAGCTAGGCAACCTCAAGACGTTCGAGGTGAAGAAAGGACTAGCGGATCTCGACAAACTTGTG
GAGCTCATTAACACAGAGCTCCATGCGTAGAGTAGACAGGTGGCACACAAACAAAGCAGAGCGTACAATTTTTTTTGGTCTGCTTAGTGTTGTTATTTTT
GCTCTGCTGTAGTCTCGCGCTTATGAACTTAACGTTACTGTACTGTAGCAAACACGCGTCTCCGTCACTCCAAACTCTTCGAGGTTTGTTGTGGTACTCA
GTTGAACAGGTTCATCTCCTGGCGTAACTGGACTAACGCGCTGTTTGCAGTGCTCGAAAGATGCAGCATGCGGATCTGACGCAGATAATCCCGCGCGGTG
AGAAGTTCCTGGCTCGAGATGTGGCTGGCATCAAGCAGATCAAGCCACGCACTCGCATGTTCGATCTTCGAACGCAGAAGAAAGAGATCTCCCGGTGGGA
TGCAGACACTAAGACCGTTTGTCATCACCAGTGGCTTCAGCTTGTTCACGCATGCGCGCAGAGTATCGATTGAGTTACCGTCAGTCGTAGAGGTATCATC
CGACGAAGCAGTCGACGGCACGGACGTATTCCCCAAATCAGCAGCACAGTGTAGCGCCTCGGCCAAAGACGTTTGGGCGAGCGTAATTGCTTCACCTTGG
AGACACGTTTCATCTCCAGACACCAGCAAACGAGTGACTCGATCATTCGATTTATCCGAGATCACGACTTCCAACTCGCAAGTCGCATCCAGCTCGAACG
CGATCTCAAGTTTTAGAATGAAAGGGGAAGATGCGCGTTTCCCATCGATAAGAATACGACCCAGACAGTGCTCCAGCCTATTCGGAGTAGCGCCGGCAGT
GCGATTCGCAACTAACCCTTCCAGAATGTCAAACTTGATCTCCCGTTGGCAACTTGCGTAGTACAGTTGTGCTTGTCGCGTCGGTACCGTCGAGCTAGGA
GGCACTACAATTAGTGTATCTCCACTGGAACTGCGAATCCCAAGCGACAACGGCGTGGTCTCATTCTTCAATACACGACCACTGCTCTGAGCTGCAATCA
TCGCTGCACCAATTGCAGCGGTATGTTTCGGTAGATCCACGATTCGATTCCAGTGTTCGGCAAAGCAGTCTCCAAGAACTTCACGGAGTTTTGGCACTTG
CATGGCTCCTCCAGTGACCAAGACCGCATCAACGTCCTCCTTCTTTACTTTCGCGGTCGCGAGAACTTGCTCAACGGTGGTCGGCAAGCAGTCCCACGTC
TCCGACCCACACAACGACTCGAAATCTGCTCGCCAGATGCTGCTACTGAACCCTGTCATCACTCCATTGACTGCACCAGAGCCACAGGCACGTCGAGGCT
GCCAAGGCAGATCAATTGCAGCTTGCTGTGAAGTCGAAAGGATCCTTTGAGCCAACATACACGCACGTCGCAGGCGTCTGGAAAATGCTGGACTTGTCGA
CTTTGAACTGGTGTCGACTACCTTCGCCTCACTGTGGAAATGCTCAAAAAGACGATCCGTTAGAGCTTCACCTCCCAGCTCCATATTTCCTGCTGTAGCT
GCAACCTCGACTTCAATCGACGAGGAAGGTCCGCCAGCTTCACGTACCCGAGCCAATGTTACATTCAAACTTCCAGCACCACAGTCTACTACAACTATCG
TCTTCTCGAAGACAGTAGCCGCAGCGTCAATTACGGAATCTGCATTGGCGACAGCAGACGCCGTGGATGAAATAACGAGCCGCTCGACATCCAAGTTAGC
AATTCTGCAGGCGTCCCAAACGGCCTGACGCTGGGTCCGGTTATAAGCTGCTGGTACCGTCACCACAGCAGTAGTGACACGCTTTCCAGTGAAAGTCTCA
GCTCGGTTCTTGATCGTAGCGAAGAGCAAGGCTGCAACTTGTTCGGGATACACTAGATCAGGGACGTTGCCTTTCGCAGGAGATTCCACGACAGCTTTGC
CAGCAGCTCCAGCTTGAAGAGTAAAAGCCCAACGATTGACGTCTTGTGCTGAGAGCGTCTCTGTCTTCTGCCCAAGCAGCATTGTCAGGTCGTACACAGT
ATACGAATGTCCAGCCTTCGCTCGGTTAATTGATTGGAGTCCTACTTCCCCTTCTCCCGAGTGAGCAACCCCCATTGAGACGAAACTCGATAGTGAGTAG
CAGTTTTCAGTGCTATGTGGCTCAAAAGGAATCAGTATAACACTGCCTGTGTCACTGACAACGGCTGCCTCGCATTTTGAACGGCCAAAGTCAATGCCGA
TACTACAGGAAGCTGTTTCGCTGATCTCATCCATGGTTGGTGGCGTAAATTCAGAGTCGCTTGTTGCTCCAAAATCATGAGGGCTCTTGCCTTGACGGCT
ATCAGGGTTAACGCCCACCATAGTTTAAACTGAAATGGTTAAGTCGCGTTCCATCAAGCTCAACGGGTTCATCCAGGTCAAACACGTCGTTCATTTTAGG
CGACTTCAGTGTCTCAATGCTCTCGTATTTTATGTGCTTCTCGAAAACCTTTTTTTTTTTTGGGGGGGGGGGCTTCAAATTAAAGTCCTGTGAGCATTTG
GGATGCGGAGTGGTTGAGCCCCCCCTAAACGTATTTGGCGAATAGATTTGGCGCCAAAACTGAAAACGTAAGAAAATAGGAAATGAGTATTTTTTCCGAC
TTTCCGGTCAGTGCGCAAGCCAACTGTATATTAAGGGACAGATTTTATTCCGATTCTAATCAATTTTTTGCGAGAAAAAAAACACGATTATTATGAAGCA
TTTTATGAGCTGATTGGCTGTGAGAGACAACATAAAAAGAAAAACAATTAGGATGGGCAGTCGATTTGGTACTTGCTATCTTAACGTTTGTGAAGCCATC
TTATTTTTTGTATGAAAATACAGTGACCGGAAGTCTGCACATGTTTGTGAGACATCCGACCTTTACTTTGATATCTGTAAGGGGCTTTAAGTGACCGGAC
ATATGCTAGCTTTTCCGATTCGCACATCTTTAAAGTATATCCGATTTGCTTTTTTTCGTATCCGTACGAGGTATAGCGTATACGCAGCGTATACTAGTCT
GTTCAAGCAACACCAATCCCTCCCCCTCCTCCTCAGCAAACGCGCGGTTCCGAAGGAAGAAGGATGCCGCAGCCGCGAAGAGCGCAAAAGCGCCGTCTCT
CCGCTGACGACGTCGAGGACGGGAGTGACAGTCAAGCATCTAACGACTCCACGTACAAGTGGCGTGGGAATCGAGGCAAGACGACAGAGACAGCAACCAG
TACCGGTGAGGCCACCCAGGTTAAAGTCATCGCCCATCCGCCGGGACAGATACAGCTGCAGTCATGGGAAGCCTTCGAGGTCTACCTAAAATCATATCAG
GCACAGTTCTTCCAGATATGCTGTCGTATTCTTTTTTAAATCTTTATTAGCTTTATCCATGTGCTAAAGAATTTACGTGCTTGTCAGATCTTTCGATCGC
GGACGAATACCACGGTGACTGAGCGAAATTTAAGGATTGCGAAGCAGGGCTCAAAAGCGTCTCCTGTTCCCGTCGAGTGGTTTCAGTATGCCAATACTTA
TGTCTGCGCGCACCATGGGTCATACCGATCCAAGGCTACGAGTAAACGGCCTCGACAGAAGAGTCGCTCCCAAGGATGCACAGTGCATGTACGAATTGCT
TCTTTCTCACAGTTGCCCGAAGAACTTTATCAATCGGGCTGAATCTGTTCTGGTCGGGTTTCAGTCTAGATATGGTGGGGATTAGTCGGGCCCAAGTTTT
AATGCGGTTATTTAGCTCATGATTCTATTGACCATGACCTTGTTCTATGCCACCACTTTTCGTGTAGATAAACGTCTGCGTCTAAGTGGTCGCCAAGGTC
AACAACACGTTCGCACTCGTGATTACTAGGTGCCATCTCGAGCAGAATCACAGATTGAGCGAGTATTCTTTTAAGGGGCACTCCTCTAAGTATATCGCTC
TCGATCAGGGTGCGTTGCAGACTATCAATGAGCTACAGAAGGCGGGGC