Description :
From Genome Similarity Track
Location :
Scaffold_867:3421- 4902
Transcript NameFunction/comments
Phyta_totarag11112hypothetical protein

Sequence
1481 bases(100 bases per row)
ACCCTTCCTCCTGATCTGTGACCTCCTCGCAGATCTCTAATCCAACCACTCATGAAGCGACCAACTCACGCCACGATCTTGCCGTCTTACTACTCCTCGT
GCGACTGCATGGCCTCAACCCGGTTCCGGTTGGCTTGTTCACACAGGTAGTCGTGCAGTACAGCTCCGCAGTTGAGATCGGCTTCATCCACCCATGTTGA
TTCAGGGTAGCACTTCCAGTGCACCAGCAATTCTCGTAGTGCTCGTCTGCAGCGTGATCGCCGTCCCGATCGCATTTCATTGATGCGTTCTACCTCGTAC
TCGTCTTCGCCTAGTTCGGTTTCCCAGCTATCTTCAGGCAACAAGGCCTTATCAAAATCGAATCGTTCTTGACGTTGGACGACTAGCCGAAGACGCGGAC
GGTCGGGGCAGTCTTGTACGGGCTTAAGCTTCGACACGTAGATCACGGGGAATAAGTTGTACGCGGTGCCAGCGATCTCTAGTCGCACGGCGTGTTCGTC
GTTTTTCCTGATCACTTTGAATGGGCCGTGCGACATGTGCGCTAGCTTCCATGCGTAGCcttccttcaccttgtccagATGCAGCCAGACTTGGTTGGTC
GATTTTGATCTCGTGCGGACGCACCGAATCGTTATGATGATCTGCCCTGGTTTGGATAGCTTTGCGTGGGTACTCGATCACTTGCTCACGCACCTGCTCG
TAATGCTTCTGAACATGGTATCGCCACCTTCGAGGGTCGCAATCTTGACGCCGCGTCAATCCTAATGGGGCCATCGCTTCCATCATTTATCTTGGGTCCC
ATCCATGCGCCAGATAGTACTGCGTGTCGCCGCGTACTCGATCGTGAGCCGTGTTGAGGGCAAATGTGAGACGCTCTGCATAATTATCCCAGTCGATATG
GTTGACGTCTTCGACGTACATATTCAATGCTCGCGTTAGCGGCAGCACCATTCGTTCAGCCGCACCGTTCGCATGTGGGCGATGCGCCATAGTCGTTCGC
TGTCGTTGTCCGCTGATTTTATTAAACGATCTAAAGATGCCGGACATAAAGCCTGGCTCTCGGTCATGACGGATCGCTTTACTCTCGCCAAATCGTCGAA
ACATACACTTCTCGTCATTCTCCGCAATCGTCTGAGCAGTTCTTGATGCACTTGCCTTGGCGATCACGAAGCCGGTGAAGAGATAGACTCATATTAACAA
TTCCGTGTTGCCTTTATATGATCGAGGCAGCGACGGGATGTGGTCCACAACAATAATTTGAAATGGGTATATCGCCTGCAGGTTGTCTGGCGACTCACCT
CGAACAGTTGGCCGCTCTTTTCCAGTCTCACAGTCTATGTACTGACCCACGCAACGTTGTACACTCTGATACAGTTCTCTTCAGTGGAATGGGGATTTAT
GAGATGCTGAGCAGTTTAAAATAGTTTTTCTTCAAGACGCGGGAAGTATCAGAGTAGCAAAACTAGTAGCATAGTCGCAGG