Description :
From Genome Similarity Track
Location :
scaffold_1099:342- 3303
Transcript NameFunction/comments
g10994.t1hypothetical protein

Sequence
2961 bases(100 bases per row)
AGATGAACGTGCAGGTGTATGAAATGATGCAGAGCAGGCGAATCATTTCCTCCGGATTGATAGAGGCGGCGAACGATGTTGGTGGTACGGGGCTGTTGGG
AACGATGCTGGCCGAACTGGATGAGCACTATTCTCGGACAGATGAGGTTTTCCAGGGTTTGGAGTTCAAGACAGCGGTCCCAGCGACGTATAAACCAACA
AGAAAATGGCAGGACGGCGTCCTGTATCTGGACAGTGCGGATCGAATGGAATTCCTGTACGACTTTGAGCATACCGCTAACACTGTGTCGAAAGTTATGA
TGTCCGATCAAGAAGAGGATGTGGAGAGTCTCCTGATTCAGGAGGTGAAGGAAACGATGGCAGTGAAATATCGCGCGAAGTACCAGCTTAAACCAGGGAT
ATGCGCTGACGTGGATCTTTACGGCACCGCGAAAAGATACCGCGAAAAGGATCGAAGTGTGTTTGTGTCGCGGTGGTTTGTTGAAGGGCGTGGAGAATTT
GAGGGCTTCAACTCGAATGAAACGCTTTGGATGGTTGTTCGACCGAGTGAGTCGGATGTTGAGGGAACTTGTGGTTATACGGTTGTTGAGTGCTACGCGC
GTTTGGTGCCGATGGGTTTCGGCGGCTGTGACGAGAATATGGACAAGTTTTTGCAGTTTCTCATCAATTTGGGCGAAGAAGAGTCCAAGCAGATGGTGGA
AATGATGGAAAAGCTGCTTATTTGTGAGCCTGCCAAGTTTTTCTTTCTCAAGAAGGCAAAATACATTTATGAAGTAACGTACTAAAGTAACATCTAAAGC
TGTCAGAATGCTTGTAATCGTGACGTCAAGGTTACACTATACCACTAACCATTTTCCATGGCAGCCCACGCCACCTTCTTAGACGAAATGGCCGCGTTTC
TCGGCCAAAGCGAAGCACCAGGCGTGGAGAAGTACGGAGAAACTCCTAGGACTGACGGCGATGAGCTCCTTTTGGCCAGTCACGAGCTGCTGGCGGAGAC
TAAAGAGCTGCTCGCGTCTTATGAGGAGGTCCCACCCGAGAACAGCCAGGAAGAAGACGTAGTTTCCCCCTCAAACACTGCGAAATCGCCCGAAGAAGAC
AAGCAACAGGATGTACCGAGGGGTAAATTGTCGGCTGAAAAGAGGCGTGAAATTCGGAACGCGCAAGCTGCAAAACGGCAACTGCGACATCGTCAACAGC
TTAAAGAAGAGAAGGAAACGCTAAAACTTCAGGCAAATGAACTGTCCAGCCAGCTACAAGAGCTGCAGGCTGCTCAGACGGAGAGGGAAGCAAGACATGG
CGGGGGTGTAACGTTTGGGGCGTGGAGAGCGATCGCAGTGCGACAACTGGAGCGACGAGTGCAAGCCGAGCAACAACGGAAGCTGCTGAGGGCCGAATTG
GTCGGGAAAGCACGGCTGATTCACCAGATGAACGTGCAGTTGCACGAGGTGCTGCAGAGCTCGCGAGTTGGTCCCTGCGGTTTGATAGAGACGAGTATTG
ATGCCAGTGGAGAGGAATTGTTCAGAACAATGGTGTCCGAACTGGATGGACATTATGCTCGGATAGATGAGGTTTTCCAGGGCTTGGAGTTCAAAATGTC
GGCCCCAGCAACGTATACACTCACCAGAAAGTGGCAGGAAGGCGTGCTGTATCTGGACAGTGCCGATCGAATGGTATTCCCGTATAGCTTCGAGCATACC
GCTAACGCTATGTCGATAGTTATGATGTCCGGCCAAGACGAGGATATGGAGAATGTTCAGATTCAGGACATTAAGGACACCCTGACGGTAAAGTTTCACG
CGAAGTACCAGTTTAAACCAGAGCAATACGCAAATGTGGATCTTTACGGCGCCGCGAGAAGGTACCAAGCGAAGGATCGAATTGTGTTCGTGTGGCGGTG
CTTTGTTGAAGGACGTGGGGAAATTGAGGGCTTCAACTCGAATGAAACGCTGTGGATGGTGATTCGACCGGGTGAGTCTGAATTGGAGGGAACTTCCACG
GTTGTTGAGTGCTACGCGCGTTTGGTGCCGATGGGTTTCGGCGGCTGTGACGAGGATATGGACAAGTTTGTGAGGTTTCTCGTGAAATCGGGGGAAGAAG
AATCCAGACAAATGGTGGAAATGATGGAAAAGCTGCTAATTTGTGAGCCGTGATCTCAATGACAACAGTGAATCAAGTTTCCAGCACCCCTGCAAATTAC
TTGAAAGTATATGCACTGCTAAATAGATCGTAAACATATTTTTTTTTCAACGTAATGACACATAATGACGGCCAGTCAGACTAGACACTAGGGGTATTCG
CGAGAACGATCCACGCATCGGACACGCCGTGAAAACCGCCAGACAAGCAAGCAGCACAATCTGAGGAAAAGCTGCAAGGAACCAACACGACAACAGCGCC
AGCGCCTCCCAACAGACAAGGGCGAACCTTTGTTGCCGTCGTGACTGCATCCAAGCGCTCGAAAGAGGCAAACACAGTCGAACGGCAACCCTTTGGAAGA
ACGCGGCACCGTCACCACGTACACCTCCCCACAACAGCTCCTCTGCTCCTCCAGCTCGCACTGCACTGAGCCTGCATCAGTCTCTAGCTATTCCATTGTG
CTCCCCGATACTTGGACAATACTTGGCAAGAATTTCATGAACTGTAACATACCTAAAAGACGCTGCTACAGCACGAGACACCTTCGAACCACAGGCGACC
GACGCAGAGCTAGGTAGAGAGAGGGACTGGAACGCAGTGCATCAAACTCCAGACACACTCCAAGCTGCAAAACGAGGTAACAAGAGACACTGGAACAAGA
GTAAACCAAACTGTAAACAAAATCCACAATGCAGCAGAGGGCACCAAATCTACACACGACATCAAAGTCCCATAGACACCACTGAAACCCCATCATTTCT
TCATCCTTTTGTCACCCCATTGGTCCAAGTGTGAGGAGAAGAAAGAGGTCAGCAAATAACA