Description :
From Genome Similarity Track
Location :
Scaffold_1922:342- 2650
Transcript NameFunction/comments
Physo_126918Os02g0712000

Sequence
2308 bases(100 bases per row)
TTTTTTTTCATTTTAGGGCCTGTGAGATTGAAAGCATGGCTAACCGGTCAAGTGAAATTTGGGTAGATCGAGCTTCAAATTGAGCGATCCGGCGAGTTGG
TGACGCACAAGCTACAAGTGCAAGACCTGCACGCCGTTACTCCGTCGCGTTTTATTGAGATCGGCGGTGCGGTGATTAACCCACTTTCGTATCAACAAGC
ACGAAATCATGCAATGAGCCCTGGAGCGCCGTACGTGGCGGACCCGGGTTACTTCCTGCAGCGTTCTCGCATCGGCCGCGGCGCTATCATCCACTCGGTG
AATGGGATTAAGACACCCGATCTCGAGACGCTTAAGAACTATTTGAAGCAGTGCAAGGACCGGGATCGCATCGTGGTCAAATTCTCGAAGCTGACGGATA
AGCCGGAGAAGGTCGAGGTCGTGCATGTGGATCGGAGGTGGTTCCCATTCTGCGAGTACGTGCGCGATGATAAGCTCGGCACGTGGCATTGCGAGCACTT
CGCCCCGCCCGCTGAAAGCACGGGTACAGATGCCAAGCCTTCTGGAGAAAAAGAACCGATTGGATCGACAACGACACTGCCTGGTAAGAACCCGGTGGAG
AACAAGCTAGCGCGCTCGCTAGTAACCGTGGACTTTGATCGCCCATTTAGCGTGAACAGCTTGTCAACATCGAACTACCGTGGCACAGGACTTGTGATCG
ATGCGGAAAAGGGACTCGTGGTGGTGGATCGCAACACCGTCACTGACTCGATGGGTGATGCTATGGTAACCTTCGCCAGCACTATCATGGTTCCAGCGCA
TGTGGTTTTCGTGCATCCGGTGCATAACTTTGCCATTGTACAGTACGACCCCAAGCTCATTGGGTCAACCCCTATTGAAAGTTGTCAAGTGGCATCCAAG
CCGTTGGTACCCTCCGATCCGGTGTGGCTCGTGGGTCTCATGAGCAGTGTGGGGCGCAGCGGCCACTCGGATCTCGTATCCCGGGAGACCATCGTATCTG
GCGTCAAGTGGATTGGGTTGCCCATGCCCAACCCACCTCGGTATCAGGAACACAATCTTGAAATGGTGGCTTTGCAGGATGTCGTTGGAACTGAAGGCGG
AGTTGTATGCAGTGATAAGGGCGAGGTGAGTGCTTTTTGGGCTTCGTTCTCGTTCCAGCAGCAGCGCCGTAGCTCCAAGGTGGAAAGTCAGTTTAACCGC
GGAATCCCGATGGAGCTGATTATGGAAAGCGCGGCACCGCTCATGCGAGGTGCGACGCCCCGAATTTTCGATCTGGGGGTGGATTTTGAGCACTTGAGCT
TGGCAAAGGCTCGGGAACTTGGGCTTGGGCAGGCGCTAGCTGAGATTTTGGAGAAGGATGCGCCAGACCGCCGAACTATCTTGAGTGTTGCGCGTCGGTG
GGGTGGCACGGAGGCGAAGGATGTGTTGAAGAATGGCGACATCTTGGTGGCTGTGGACGGCAAGATCGTTACAAGCTTCCGCGAAGTGGAGCGTTGTACG
CAGAAGCCGGAAGTTCAGCTTACGATTGTGCGAGATGGACGCGAAATGCAGTTGGATGTGAAGACTCTTTTCATGGAGCGCACGGAGATCAACCGCATTG
TCTTCTGGCAGGGTTTGCTTCTTCAGGCACCGCCTCTGTCGGTATCAGCGCAGCGCAGCATCTCACTGGAGGACGGTATCTATGTGTCTTGCCGATACTC
GGGCTCACCTGCTGCCCGCTACGGCCCTCCACCCACGAGTCGGATTAAGGAAATCGATGGCGTCAAGATCACAAGTATCGACGATTTCGTGCGCGTCGTC
ACTGCAAAGTCAGGAAATGACTCGGTGCGCATCAAGTACACGGATCTGAGTGGTAAGGACCGCCTCAGCACTCTCAAGCTTGAGCCGAAGTACTGGCCCA
CCAGCGAACTGGTGCACGAGGGAGGCGAATGGCATCGCCACCAGCTCTGATCGCAGCTTCGTCCAGATCTGGGCCACTGTACTCACAGAACGAATGTGAA
TTCACACAACACACAACAAACAAACCAAGTCAACAAACACGTAACAAAAGATAAAGGCATGTTCGGTTCTTTGATCCCCAAACGGTCAGTGTTGATAGAA
TCCCTAGTCAGAAGGTAAGACCCTACTGCCTCCGTTGTCGGCACTAGCAGTAGCAGCTTTTATTACTTGTAGTGACCAAGTGTCCATATTCTTTTCACCG
CCCAGCACCCGGTCGAACGCACTCACTACACCCGTACACGGACGCTCCTCGCATTCGCGCCCGAGACAGCGCCGATCACGACCAGACACTCTCGCGCGGA
ATTGTAAA