Description :
From Genome Similarity Track
Location :
Scaffold_1452:342- 2404
Sequence
2062 bases(100 bases per row)
TTGTGGTCATTCGACCCGACATCATAGAGTTGAACTATTCTTCAATTTTGGATGAAGCCGTTCCGGAGGACACAAAAGCAGCACCCAGCGCGCTTAGTGG
GTCATAAATATTGAAAGACCCTCATGATATCTTTTATTCCTTAGTCCAGGAATTTCAAGATGTGGTGTGCCGCGACCCACCCTCATTTCTACCTCCAGAT
AGAGGTGTCCGTCGTGCAATTGACTTAGTTCCTGGGACGAAATACTGTGTCACACGACAGTGGCCCTTGCCTAAGGAGAAATGTGATGTCATTGATGACT
TCTTCCGTGCTAAGCACGAGGCAGGAATAGTATGTGAGAGTAAATCTCTACATTCGACACCGACGTTTTGTGTTAAGAAGCCGAACGGCAAGTGACGTAT
TGTGCATGCTTCTAACAAGTTTAATGCGGCTACGATTCCGGCACAGACACCCATTCCTCGAAAGGTTGTTCTTCAAAACAACATGGTTGGTTGTACTATG
TATAGTGCAATCGACTTGGTCGATGGATATTATCAATTGCTCATGCAAGCGATTGCTATTCCGCTTACAGCAGTGAGCACCCCGAGTGGTATGCTATGGG
AATGGCTGGTGATGCCCCAAGGGCTGTATAATTCTCCGGCAACATTTAATCGTCTGGTGACGCAACTTTATCCCCACACAGGGATTACGCACAGACGTAC
TTTGATGACATTTTTGTCCATAGTCGTGCCGAAAAAGGTCGGTCAGATGTTGACAACCACATCGGTCATTTGCGAGCCGTGCTCGAGTGCATGCACACTA
ATAAATTGTACGCCAACGCGTCCAAATGCATTTTCGATGCAGAGGAGATTCCTTTTCTCGGCTGTTTCATTGGTAAGCGCGGCCTTCGAGCGGATCCCGC
TAAGTTCAAAGCTATTGTGGACTGGCCGATTCCTAGGAGTCAAAAGGACTTGCGTAAGTGGATTGGCCTTGCCAATTACTTACACAAATACAGTAGAAAT
TACGCTGATATGGCTCGGCCATTAACTGATCTCCTTAAGAAGGACACAGATTGGCGCTGGGACAACACCCATGCTGAAGCATTTCGGTCAATCAAGGAGA
GTCTCCTTCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTCAGTGTTGTCTGCGATGCATCCGACGTGCCATAGGCAGCGCTCTATTACAA
TCAGATGCTGCAGACCGCGAGCGAGATATCGCATTTGAATCACGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTCCATGACAAAGAGCTACTTGCTA
TGAAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTTCAAGCCATTCGTCATCTATACGGATCATGCGTCATTACGCACGGCGAAACAGTCACC
TCAACTCTCTCAGAGAATGGCTCAGTGGCTTACCTTCTTTGCGGAATATAACTTCGAGGTGAAGTATAAGCCAGGCAAACAAAATGTGTTGGCAGATGCC
CTCTCTCGCCTTCCGGATTATGAGCGTGCTCATGTCACGACTTTTTCGTCTCCTATTGAGGAGTTAACTCGTGTGGTACATTCACGGGATTCTCAGTGTG
TGGCATTGTTTCATGCCCTTGGGAGTGAGGAATACAAGGACTCATTCAATTATCGGCACGCTTGCGGGCCAGCATACATCGATATTCCATCAATAATGGC
CTCTTGTGCTATCGCACAGATGTAGCGGATACCGCTCGCATTGTTATGCCTCACAATGAGGATCTAAAATATCGAATCCTCTTTGAGGCCCACGATACTA
CCCTCAGTGGGAATTTGGGCCGGGAAAAGACTTATGGCTCTATGAGTCAGCCCTACTGGTGGCCCAAACTCTACAAACGGGTGAGCACATACGTGCGTAC
GTGCGAAACGTGCTAGCGGGTCAAACCCTCGGCACATTCGGCTGCGCCACTCGCCAGTTTACCTGTGCCCACGGGATGTTGGGAGTCCATCAGTATGGAT
TTTGTGTTCGGTCTTTCCAAAGACTGTGACGGCAATACGGGAATCGTGGTCTATGTTGACCG