Description :
From Genome Similarity Track
Location :
Scaffold_10:342- 1556
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_10-fgenesh-gene-0.0Sodium/hydrogen exchanger

Sequence
1214 bases(100 bases per row)
GTCGCTGAGCCACCACCTGAACCTGGACAACACGCTCTTCTTCGACGTGCTGCTGCCGCCGATCATCTACGAGGGCGGCTTCTCGATCAAGCGCCAGGCG
TTCTTCCGCAACTTTCCCGCGATCATGAGCACGGCTGTGCTCGGCACGGTCATCGCCACGTGCATCACGGGTGGCGTGCTCTTCTTCGCCGGTCAGGTCG
GCGCCGTCACGGCGCTCTCGTGGGTCGAGGCCTTCCTCTTTGGTGCGCTCATCAGCGCCGTCGACCCGGTCGCGACGCTCGCGTGCTTCAACAAGCTCAA
CGCGCCGCCGCTGCTCTTCAACCTGGTCTTCGGCGAGAGCGTGCTCAACGACGCCGTCGCGATCGCGCTCTACCAGACGCTACTCAAGTGGAAACCCGAC
ATTGACCTGAACGCGCGCGAGCTGCTGCTCGTCGCGGTCAACACGGGCGGTATGTTCGTGGGCTCGCTGCTCGTGAGCTGCGTCATCACGCTCCTTGGCG
CGTTCTTGCTCAAGCGCAAGATGTTCGAGACGCTGCGCCACTTCCCGACCTACGAGATCTCACTCTGCCTCATCTTCAGCCTGCTCACGTACTTTGTGGC
CGACAGCATGAACCTGAGCGGCATCGTCTCGCTTTTCTTCTCCGGCACCATGACCGCGCACTACCACTTCCACACGATCTCCAAGGCCGCGCAGCACTCG
TTCACGCACCTGCTGCACACCACGGCGTTCATCTGCGAGAACATTGTGTACGTGTTCATGGGCACGTCCGTCATCATGCTCTTCGCGGGCCACGTGGACA
AGGACGCCGGCGCGGCGCTGCGCGTGGACGACATCGACTGGAGCTTCATCGCGCTCACAATCGCGGCCTGCGTCGTCGCGCGCTTCTTCAACATTTTCCC
GCTGCTCGGGCTCTCGAACTGCTTCCGCTCGCGCTCCGACAAAATCTCCACGAGCTACATGACGGTCATCTGGTTTGCGGGTCTACGCGGCTCGATCGCG
TTCGCGCTCGCGAAGAACTGGTCGTACATTGGGCTTAAGGGCAGGTCGCACCACAAGCTCATCGAATCGACAACGCTCATGGTCGTGCTCTTCACGACGA
TCGTCGTCGGTGGACTCACGGGTCCGTTCCTGTCGCTCTTGGGCCTGGCGAACAGCGAAAAGAAGGACCGAGCGCTCCGCACCGGTGACGAGTCGGACGC
TGGTACATCCACTG