Description :
From Genome Similarity Track
Location :
Scaffold_977:3419- 4423
Sequence
1004 bases(100 bases per row)
ACGCGGAGCGTGGGCTGCGGTTGGCACTCAGTGCTGCTGCTTGTCGTGGGCTGTGCCCCGGAGATAAAGACGCGGAGCGTGGAGTACGGTCAACAGACCA
AGAAGCTTTCTTGCTGCCAGCCATCGATGAGCCACGGGTGTGGTGCGCTTGTTGAACTTGGAAAGTTCTTGAGCGAGGTCCGAAGACCAAGCAGCGATAC
CTCTGATGAGGGAAAGTGACGAGTGTCGACACGTGGTGTCAACAGTCTGGTGAGGGAGGGTGTAACGGGGTTTACACGTACCCGTTAGTGTATCGTACAC
GAATAGTGTGTTTCACACAAATGGTGTGCACACCCAAGTTGGTGTGTGTGCACGAGACTTAGGTTGGTGGCCTCACAGCCACCCGTCATGCATATTACTA
GGCTCCACTATGGTAGATAGTGAGTGTTATACATTTACCCCACTGGTCGCCCTGCCGCGAATAACAACAATAAAAATCAGTTCACGTTTTGAAGTCTAGT
GTCTATTAGCCTTATTTAAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACAGACTGTACTTGGTTCTGGTATAGAACCTAGATTTACAACC
GAACTAAGACTATGAGAGTCTACGTCTTCCTCTGACGCAAGCTACGGCAGCCCCGCTGCAGCAAACGTCCCACACCGGAAATGCTTGCGAGCTCGCTTGC
AGCCGAGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACATCTGTCCACG
GCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCCCGGTCAGGGACCGAGA
CGCTACATGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACACTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAA
TATG