Description :
From Genome Similarity Track
Location :
Scaffold_49:34184- 35855
Transcript NameFunction/comments
Phyta_totarag2171hypothetical protein PHYSODRAFT_354955

Sequence
1671 bases(100 bases per row)
CGTCTCTTTGAAGCGGAGAGCGCCCACACAAACATCATAGCGCAATTTGCTTCAAACCCCGCAAGCAGAGCCCGAATCAGATCAATTAAACCAACCAACG
AAATGGTGTCCTCGCcgctgccttcgtcgacgctggacgCTCTGGCGCCTCCTTTCTATCCATCCATGTCGTGGTACCCGGTGATCACGGACGACTACTA
TCTGGAGCGCCCGCACTCGCCCGGCAAGGCTGGCTTCGTGATCGCCGACCCAGTGGAGCCCGTGCAGGAGATTCCGGACGAGGAGCTGTTCGACCCCGCG
TACCACCCGCTGTCAGCcacggagatgcaggagctggagcaggtggacgagatcaatGAGATCCTGGCCGAGCTGGACCTCATGGAGAGCCACCAGGAGC
TGCACTATAAACTGAGCGAGAAGACGCGCGAGCTGCGCTCCAGCTCAGACGTGGACGCCGAGATCTACAGCATGATGGCCAAGgccgccaaggccaagag
cttctcctccaagcagcaggttcatctgcagaagaagaacagctTCCACGCCAAGAGGAACATGCGCTCGGCGCTGCACCAACCCCGCTCGGTGAAGTAG
AGCCCCCGCACGTCGACCCCTTTTGACGTGCGGCGGCACCTGTTTCAACGCAACGGAGTGAGTGAGCAACGCGACAAGCGACTGCGTGTGTCAAGCAAGG
TACGCGCATCCATCCAGAAAAAAGGAAGGAATACACGCTCCATCTGACTCGAAAGAGAGAAGAGAAAAACAACCATCCAGCTAGCCAGAGCTCTGGTGCG
CGTCCTGTAATGGCAGGACGGGCATGAACTCTGGCGACAACAAACCATACAACCGCGGACAACTCGTGCTACAGAATGTCAGCAAGAAAAATAGTAAGTA
GCAAAGGTAGGACAGAAAATAGTTTAGCGTCGGCGAGAGAGGAGAGAAGAGAGAACGGCATGAAGACGAGCAAtgagcgagcgagcggcGCGACGATGGG
ACTGGGACACGAGCTTCTGCACACAATGGCGTCCGATTGAAGGCTAGCCGACCCGAAACAGAGCTCCATGACCCCATCGCGACGTCCGTGAAAGCAACGT
CCACTGTGAATCACGCAGTACGAGTGTACCAATATCCCTAGAAAAATTATAACTACAGTAATGTAAGATGGAGCAAGTTTTTCAAACAAACGGTgcgtgc
ttcttcactttgTCTGACCGTCTGCTTCAACTCAAGCGCTCAATGCGAGGCTGACGGGGTGTGAGACTCGGCAGCGTGGGTTTGGTTTGATGATATCGAT
GACTTGTTGAACCAGGTTGTACGTGAGCGAGCGCTTGGCGGTCTTCGGAGCTCAAACTTCTGATGCGATCGAGGTTGATCTCGTCGGCGtagctcttcat
cgctgcttCGTTGTCGAGAAAGCTGTCCAGCAGTCCGCGGCTCCCAGAATCACTAGTCGTCGCTGTTTGAAAGTGAATATCGGGAACGCTCATCTGACCA
CGTCGGCATCGACGCAGCAATATAAATCTGGCAGCAAGACAGCCCTGaagcaagagcaggaagcgcaCCGGTGCGTTTGGTGCCATGGTATGCAACGAGC
GAGTCTCGGTGAAATGGCAAATGAGCTCTAATGGAAAGGGCTTGACTTGGATTGATGGCAAGTCCTGCTGG