Description :
From Genome Similarity Track
Location :
Scaffold_46:341801- 378861
Transcript NameFunction/comments
Physo_136535ribonuclease II family protein
Physo_117755eukaryotic translation initiation factor 4E member 2 isoform 1
Physo_157435hypothetical protein
Physo_108957p27BBP/eIF6-like
Physo_136539hypothetical protein
Physo_136540PREDICTED: similar to myosin IB isoform 3
Physo_136541hypothetical protein
Physo_136542hypothetical protein
Physo_136543hypothetical protein
Physo_136544tripeptidyl-peptidase I
Physo_157437MGC80971 protein

Sequence
37060 bases(100 bases per row)
GGACATATCGGGCGCGAGAAACTTTTTCTGAGCCGAGAAAACATTTCTGCCAACAGTAGTAATCGCGATAGTAACGCGATTACTAATATCGCTCGCGATC
TCAGTAGTACTATCACATATTCATCAGTAGTACATGAATGTACTACTGATAGTATCAAAATTACATGAAGTAATACACCAAATGAAGTAATACACCAAAT
TGAATTAGCCGCAAAACGGAGTTGCCCGCCCACCAACCGTCATAAGCGCAATAAGTGCCGATGGCTACCGAGACGGAGACGCCGCTGCTGTGGTGCGTGG
ATGAGCTCAACGTGGCCACGCGCCGCGGCCGCGTGGTGCGTAAGGTGAAGGAGCGCTATCTGCGCGACGACCTGAGCTGCTCGCTGCCGGCGTGCGCGCT
GTGCAGCGCCGACGACGACGCATCGGCGGCCACGCACGTGCTGGGCACGACCAAGACGCTGCTGGGCGAGACGCCGCGCGACGGCGTGTACCTGCTGCCG
TCCATGAAGACGGTTCTGCTGCAGATGGACGCTCTCGAGTTCTCCACCAAGAAGAAGAGCAAGAAGACGCAGGTGGACTCTGCCGAGGTCTTCGCGGACG
TCCTCGTGCTCGAGACGGTCTGGGAGTATGTCAAGCGTCAAGACCTGGGCGTCTACAACCGTCTCCGAGCTTTACTCATGAACGCCGACCGCCGCTTCGT
CGTGTTCGCCAACGAACACCACAGGTCCACCTTCGTCCAGAAGAAACAGATGCTGCCCAGAGGATACCAGGAGGAGGACGCTTCGGAGGACACTGCGGAG
GACACCAGGGAAACCGAGACCGACCGCAACGAGCGCGCCGTGGCCACGGCCTGGAAGTGGTACGCTGACCACCTCAAGGAGCTCGAGCGCAGCGACGTCA
AGGTTTTGTTCGTGGCCAACGACGCCGAGGACCTCAAGCACGCCGAGCAGTACGGAGTCACTGGAGGCGTGACCATCGCGGACTTCTTGAAGCCCGTGGC
CGCGCAGTACTCGGAGCTGCTGGATCTGCTGTCGGCCTCGGCTGCGGAGGAGAAGGAGCTCGCGGCGGAAGGTGTGAGCAGCACTGCCGGACGTGGAGGC
AAGAAGAAGCTGTACCCGGAGCACCTCCCCGCCGCCGAGTTGCTGGCGGGCATTAAGAACAAGAGGTTCTTCAAGGGAACGATCCGATGCAACCGGGACC
ATTGGCTGGAGTGCCACGTGCTCATCCACGGCGCGAACGGCGTCAAGATCCCCGTGCTGCTTCAAGGTCGTGAGCACATCAACCGCGCTATTGACGGCGA
TCTGGTCGCGATTCAACTGCTGCCGAAGAGCCAGTGGAAGAAGCCGTCGGACTCGTTCGCTGCCAATGGTACGGCTGCTGCGGAAGCAGCGGAGGAGGCT
GACGACGATAAGGAGGTGCAGCCGGAGCCGGTGGGCGTTGCGGAGCCTACGGTGTCGCTGGAGCAGGTGGCGCTTGTGCAGAGCGATGCATCGCAGAACG
CCAAGCCCGCTGGCCGTGTTGTTGGCATCATTCAGCGCAACTGGCGCAAGTTTTGCGGATCGCTGGAGCCCCCTCGCGATGGCGCGACGCTCAACGCGTC
TGGTAGCTGCCTGGTGGTTCCCGTGGACCGCAAGGTGCCGAAGATTAAGATCCAGACGCGTCAGCAGGAGACGCTTATGGACAAGCGAGTGCTGGTGGCG
ATTGACTCGTGGCCTGCGGACAGCAAGTTCCCTCTGGGTCACTACGTGCGCACGCTCGGTGTCATCGGTGACAAGGAGACGGAGACCAATGTGCTGCTTA
TCGAGCACGACATCCCGTGTGACCAATTCAGTGACGAAGTGATGCGTTGTCTGCCGCCGGAAGACTGGAAGATCACCCCCGAAAACTCGACTGGGCGTCG
CGATCTGCGTCACTTGCCTGTCATGAGTATCGACCCGCCGAACTGTAAGGATATCGATGATGCGTTGCACGCTAGACTGCTTCCGAACGGAAACCTGCAG
GTCGGGGTGCACATTGCCGATGTGACGCACTTTGTTGCTCCTGGTAGTCCTCTTGACGAGGAGGCTGCTGATCGTGGCACGTCGACGTACCTTGTGGACC
GCCGTCTTGATATGCTGCCTGGCCTGCTGACTACCAAGCTTTGCTCGCTTACGGATGTGGAAGACCACTTTGCTTTCAGTGTGCTGTGGGAGCTGAAGCT
TGTTGGCGATAACGACGTGCAGGTCATTGACGTGTCTTTCTGCAAGAGTCTCATCCGCTCCGTGGCATCGCTGTCTTATCAGCAGGCTCAGGAGTTCTTG
GATGACCCCAACGCTGGTGGAGTGTACGGCCAAGACACCAATCCAAAGAAGAAGAAAAAGGGTGAGACCGAGAAGGAGTTTGAGCGCAAGCAGTTGCTGG
GAAGTGGCATCAAAACGCTTAATGTGATTGCGAGACGGCTTCGTGCCAAGCGTATTGAGGCAGGCGCCTTGACGCTGGCCTCGCCTGAAGTTCGCTTCGT
GCTTGACACTGAGACCCAGAACCCGTTGGATGTCCAGATGTACACTCTGCGCGATACTAACGCACTTGTCGAAGAGTTCATGCTGCTCGCCAACATCACC
GTTGCCAAGAAGATCGTGCGTCATTTCCCGACCTTCTCCATGCTCCGTCGGCACCCGGCGCCTTCGAAGCGTCAGTTCGACCTGCTTTGCAGTCAGGCGA
AGGCGGTTGGAGTCGAGCTGCACGTGGACACATCGAAGCAGCTGCAAGACTCACTGGACGCCGCCGACATCCTGGCGCAGGAGGAAGCTGATGGCAAGAA
CAAGGGCAAGCGGAAACACGGAGGCAAGTCGAACCCGTACTTTAACAAGCTGCTGCGCATCATGACTACTCGCTGTATGATGCCGGCCAGCTACTTCAGC
TCGGGCGAAGTTGCTCCGCCTGAGTTCCATCACTACGGTCTGGCAGCCCCGATCTACACGCACTTTACGTCGCCTATCCGTCGCTACGCTGACGTGGTGG
TGCACCGCCTGCTGGCTGCTGCCATTGGCGTGGCCCCACTCCCGAGCTACCTCGAGAACAAGTCGCACCTGCACGAGATCAGTGAGCAGCTCAATCGGCG
TCACCACGCAGCTCAGCTAGCTGGCCGAGCTTCGGTGACACTGCACACGGTGCTCTACTTCCAGCAGTACCCTACCCGTACGGACGCCGTCATCACGAAG
GTCAAGAACAATGGTGTGGCCGTGCTGTTGCCGCGCTTCGGTATTGAAGGCATGATCTTCCTGTGCGAGAAGGACGAGCAGGAGGACGAGGATGTCGTGA
AGTACGACGCTACCCGCCACTCACTCACCCTGGTACAGAAGAACAACCGGAAGCTGCAGGTGTTTGACCGTGTGCGTGTCAAGGTCTACGTGGCGCTGAC
GTTCGGCAACCGCCAAGAGCTCAAGATGGACTTGCTGGACGAAGACGACGACGAAGATGACAACAAGGAGGACGAGGCTCAGAAGGAGGCCGAAGCCAAC
CTGCGTGCCGCTCGCAAGAAGCGTAAGGTGGCTGCATAAATGTCACCAGAGATCCAATAGTACGTACGTATCCAGAATGCCTCTCTGTCCCTCTTTCATT
TTGCTTTGCAAAGTACTGTAGCTGTCAAGGGATTCGCAACGCTAGCAAGGCACGCAGTCTGGCCATGCGTTTCTTGCAAAGGAAGCTCCGTACGTCGGAC
GGACGCCTGTGCAATAGCTGCCAACTCACTCCGGCCCGTATCGGGATAGATGATCATGAACTTACAGTTATCGAGTGAGACACAAGATGTGAATGTGTTA
CTTGACAACATAAATCAACGAGATGCTAGCAATGCAAAAGAAAAACAACTAGGGCCGTGACGCCCATCGCCACGCAATTCACTTCCTGGGCTTTGGGAAG
TAGAGGTCGATCTCCTCTTGCGAGAGCGTCTTCTTCCCGCCGAACTTGAGTCTGGCATCAATGAGTGCTTCGAGCCGATGAATCTCGTCGAGTGTTAGCG
TATTAGCTGGGACCGCGTCCCTCTTCGGGCGATCGTCGTCGTCATCACCGTACATGAGGAATGGGGCGTGCACCGAGCCATCCGGAAATCCAAGCTCGGC
CTTGATCGGAGGTTCGGTAGAGGAAGCGCTTTCGTGATCAAAGTCGGGGGCAGCTTGCACGGCGTAGGTGGTTTGCGCGGCGCGGATTGCTGGTCGCTGA
AAGCTTCTTGCGACCGACCTTGGGTGCAGGCTTTCCGCGTCGCTCAGACGGGAAGATCGTCGGAAGCACTGAAGAAAACTTGCGCAGATAGGGTGAGTGT
ACATGCTCTTTTAGGTGTTTGATGTGGATCCGCTGGTCACGCGCCTTGCAATTCGAAAACCCAATGCCCACGATTTGGGCGACAAGTGGGGCTAGCAGTC
GCTCTTTCGACTTGGCCAGTTTAGCCCGAGCGTAGGCAGCTTGGTTCTCTCCCAGCCAGGCCACGAGGATGTCCATCCGGCTTTGACCGGTGTGCCCAGG
CTGCAGCCATTGTAGTATTGGGTCATTGCTTCGATCCCAACAACAGAGAAAAACGTCAGTATTCACGCACAACTAGGCAGAGCAGCACGAATACACGTAC
CTAACTAAGCCGGTGATCTCCGTCTGAATCTCATCGATGGTACACCCCCGAAAGCCAGCCGCCACCAACCGCAGGCGGAATCTCTCCACAACTTCGGCAA
GGTTGTTTGCGCGGAAGTAAGCGTCGTGGTTGGAGGCCAGCCACTTGACCAGCATAACTCGGGGCGTTTTGCCGTTGATCTCGGATTGCCAGGGGAAGCG
GAGCATGCGCTGCTGAGTCTTGGACATCCTCGAGTGCAAAATTGGAAATGAACCCTCCTCATTCAGGAGCGTACATGTGGGACGAGCTGTCCAACCTAAC
GGCAGCGCTTGATTGAGCTGGGACGAGCTGTAAAAGACTCGACACAATGGTTCATCAAGCATCAAAGCAGCGCCAAATGTGGGGCTTGGATTCATAATGC
TTCGCCACTCCGCTCAATAAAACTTAGATCGAGCTTCAAAGAGCTCCGCTAGAAACTCTTGCACATCAGCAGGGCGCTCGCGGATGGCTGTGTTGGTTGC
CAGCACCATGAGGTGACGGACCTTGCGGTCGAAGTAGGTCTGACGCTTCAACTCCTGCGTGAAAGATGACAGTTAGTACAAACTGGAATCTTGGCTGCTG
TAGCTCAAAGCTTTGCGTACCACGTAGTTGTACTTCTTGAGGTTGAGAGTGCCGCGCACTGCATTCGCGAGAAAGTCGGCTGTCTGGTCGGGCTGGTAGA
GCAGCACCTCTTCGAGCACCTTCGTCAAGACGGGGTCGACCTTCGTCGTGATGTACTGGTACGTATCATCCAGAGCAGCCTTGAGATAGGGGTCGTGCAT
CCAATAGCGCTCCTGCTCTAAGGCACCCGACGTTAACACCAGCATGGTCAACAAAATAAGCACGCGCACACACATCGACAAACAAAGCGCTTACCATCGC
GAATTAGAGCCGAGACTGCGACGCCCTTGTTGCGGATCTTCTGCGACGGTTGCTCCATGCCCGGGGTGTCGGAGACTCTCCGACGGAGAGTCTACACTAA
ACGAAAGCGCGAGATCTGCAAAATGGGCAAAGCGCGACAAGAGTGATCCGGCGGCAAGGCTGGTTTCGTGAGGGCTCGTATTTTTAGGCGGGCCGCGGCA
AGTCTTCTTCATCTTCGAGTCGTGTTCGAGTCACATTTGACTGGTTTGAAGTCGACTTATCGTTTCCTTTAGCAGCTCTTTGTCTGCTCCTGGCATGATG
CTGCTCCTAGAGCCGCTATGGCCGACTATACTCGAGAGAGTACCTACCTGCTCAACGGCTCTCAGCACTGCTACTACCGCTAGCACTGAGGTGCCTTCTG
GCCGCCAGCAATCGTCCTAGTGCTCTCCCTCGCCCTTGTCGTCATTAGACCTGCTGTTGCGGTGGTGGCCACCCTCGTTGCCCTCGGACTTGTAGAACGA
ACGCTTGTTGTCACGGCCCCACGCCTGTCGCTGGTGGCCAGAAGACTTTTCGCGGGAGAAGCGAGAGCCCGTGGACGAGCGTTCACCGCCCGACGAGTTG
TCACGGTTGCTGTTGTTGCCTTCGTTCTTCTCCGAGCGCCAGAGCGTCGTGTTGCGGAAGCTGGAGTTGTCGTTCAGCGACGTGTCGTGGCGCTTGTACT
CCAGCGCCACAAACTGCGGCAGGTTGAGTACTTTCCGCATAGTGTCACTTCAAGGCAAGCACACCCAGACCGCGTCAGCCAAACCCCAAACTACACCAAA
GCCCTCCATGCAACTGGTTGCTTACCGAATGCGGTAGCACGCTTCGTTGTTGTCCGCGTTGCGGTTCCAGAGCGAAATGATATCTTCGTTGTACCGGATC
GAAATGACGGCGCCACAGATCTCGTTGCCCACATCGAATTGCTCGCCAATGATAGCCAGCACCTAATCCAGCACAACACTTCCTGTCAGGAAATCCTTCA
CAGCAGCAAGCTCTGTCCAGATCTCTTGCCTCCGTACCAGATCTTCCCAGTAGCGCGAGGCGATGCCCTTGCGTAGGCGCACCATCCACTTGCCGCCTCG
TCGGTTGGCCGGGTCCTCCCACATCGGCTTGATGCCCGTCTTGAAGAGGTGGTAGTCCATGGTGTTGGGCAGGTCGTTCGGCCGCACCAAGTGGTTGTAG
ATCTTCCAAAAGTCCTGCACCTAACATTCGCAATGCAAAACAACAATCAGCCCACACGTTCTACTGCTATTTTTTTTCCAAGCCTCACCGTCTTGAAGTC
GCCGAGCCCCTTGATGCTCTTCTCATAGCTCTCCTGCAACAACCAACAACACGGCAATAATGTCAATAAGACATGCCACTTCAGTCTAGACACCACGCCC
GTATCAATAATGACAACAGCGTGGACAGACGTACGCTCACAGCCTTGTTGCCGGTGCTGCGCTTGATGTACCAGAAGCTGTACATGTTCTGGATGGGCGT
CTCCGCGGAGCCCTTGTCTTCACCTACCTCACAACAATAATTGCAATACCACAACAGCAATTATCCCATTAGACAAATGCAACACCAGCACACGTGTCAT
ATCTCCCGTCATTCCCAAGCTCAGGGGCAGTCCCAGAAAGCGCCCAGCGGCTCACTCGACAGCTAAGGCAACGCTCTACACAGTGATCTACTTACCGCTG
TGCTTGTCCTCTCCCATGGTGCCTCCTGCGTGTCTCTTTCAACGCCTCGCTCCACTTGCGGCGGCGAGCTTCTCCTTCCTATGATATTGTGGTGCCGGAC
TTCACCGGCTCACTGAGTCGTACTTAGTGCGGAGAAGCTACGGTACTTTCTTCCCCCGATTCAAATGTGAAGAGGACGATCATGGCGGATTCCGACTCGG
ACGGCGAGTTCGAACGGTGCGTATATGAAGCCTTCCTGGTGTCGGTGGATGGGTTGGGTGGCACCACCATGTCCGCCTGTTCAATGGCGTTATGGTCACG
CTTGAACCGCGCTCTAACGTGCAGTGTGGAATGATTTATTCGTGTTTGGCTGAATTCGGCCAGGTTTCTGCAGGAAGACGAAGACTCGCTGTCTCCCGAG
CCGGCGCGGCGCAGACCGAAGCCTGGTGGGGCGTATTCGTCTTCATCGGCGTCTGCAGTGACGGCGGCTGCTGCGGCGTTGCTGGCGTCGTCGAAGCTGG
CGAAAAATCACAAGAGCAAGAGCAAAAGTAAAAGCAAAACCTCCGATAAGAAGAAAAGCACCAAGAAATCTTCGAGGACCCAGCTATCGGACTCGGAAGA
CGCGCCGCCTAGTTACTACGATGACTACTCGACTGGACGAAGTGGTGGACTGGAGGACTCAGAGTATGTGGCTGTCTGACAGCGAGATGTTGAAGTTGTA
GCATGTTGAGGACTGACTGGAGGTGGGGTTAGCGCCGACCCGTATGCTTTTGACATGAGTTCGCCAGCATTTACGACTCCTGCTAAGAAGGATGACTATG
GTGAAAGCGAAAGCGAGGGAGAGTATGTTGAGAAGAAGAAGAACAAGAAGGAGGAGTTTAAGACTCTAGCGAAGAAGGCGCTTGCGAAGACCACAGCGAT
CTCGATGGAAGATCGCATCGCGGAAATCTTGAAGCGGACAGGCAGCACGCAGTTCCAAGCAGAGGAGAATAGTGACGAGGAAGATATGAGCGAAAAGGTA
CGCGCAACGCTGTGGAAGATATTAACTTGAAGAAAATGCCGCTAAATCTTGAACGGTTTTTGCATGGTAATGAACAGGAAACTCCGGCTAGCGATGCTAA
GGAGACTCCAGAACCCCTAGAAAGGAACGAGATGGCAAACGACGACCAAGACCGCGCTGGCGGCGGTGAATCTGACCGTGAGTCGGAGCGCTCAAGTTTG
TCCGATTCACTGGGGGTAGGATCAGCTGATTTCGAGGTATGACCGCCGTTCCCCTTGTGATAATATTTGTTTACCCCTCCAAGTTACTCACCAGGGCACT
GCTCTGTCATTGATCCAGGTCCGGCTTCCACCAAGGCACAGCATCGATCGAAAAAGACTGTCTCTGGTAAGTCAAGGTACAAGTTGCAGATCCCATGTAA
TACCACTTGACACGCTAACGGAACGATGTATTCTTTGCGAGTAGTCCAGTCTGGATAGCGAAACTTTCGCAGTCAATAGGGAAGCACTTGATAACGAACT
CGGTAAGACCTCCTCAGCTCGACTTGAGCGGAGTACTTGAATGAATCTAATCGATGTGTTTTGTCCTCTTGTAGCCACGCCGTCTCGGTACGAGCAGCAA
CAGATGACGTTCTCAAAGTCCGAGCAAGACGAGGATAGTACGACAGAAAAAGATGAGTATGGGGATGACGATTTCGAGCTCGATCACTCGGCAGTCAACG
ATGCGGAACCTCCACCATATTCGGCAGTTCAAGACACTGTGAACGCGAGTATTGGTGACAAATCCGAAGAATCATTCGTGAGTCAGTTTGACAAGATGAA
AGTGAGTAGCTGACAGCAACTTTGACACTGAGGGCGTATCGAACCAGCTCATGCTGACTAACCATTTTGTATAGGAACTACTACTGGCTGAACCTGTATC
GGCTCCTGCACTTAAACCAGTTGAGAGTCGAGATGAAGTCCATCCCACTGAGCAAGCGGGAGAATTGTACTCGTCCAGAAGTTCGAATGATGCTGGCGTA
CCGCAGCCACTGGAAGCTAGCGATACATTCGGCTACGGTGATGAAGAGTTCGAGGTATTTCTGAGCTTACTTACTTACAGTCTCATTTGGTTTCTGAACG
CTCACTTTTCCCATTTTTTTTTGTGCTCTAGGAAACACTAGAATCCAGGCAGGACGAGCAAATTTCCTCAAAAGTGGCAGTACGCATTCTTGTCATTTTC
ATAACGTGAATATTCGTGGTGTGGTTAACTGAATTGCTTCGATGCACAGATTCCTGAAGTCGCTCAGAACGCCACAGGCGTTGAATACAGCGCTGATTAT
GAGGCCGATGCGTTTGAAGCTGATACTGGGGCTACACACGAAGTTACAGATACTGCACCTTCGGAGCCTTTACAAGCGATCACAGAAACTCCAGAACCTG
CCGCCCAAGCTGTTGGCGATTCCGTTGTGGGCAAAGCCTCGAAGCTGAATTCGTTGCTTGCGAAATATGGCGACTTTTACACACTGGACGATGAGGATGA
CGAGAAACTGGACAAGAATGACGATCATCAACCGATGGAGGCCCAAGCGCCAATTTCAACTGAACCGGATATATCTACAGCTATAACTACACCCTCTCCG
GTACCTGCAGCACCTACACCACTAGTCGAATCACCATCGGTACGTAACTTAGTCATTATTAGTTTCTTCTATCACTGCTGATATACTGTCAACTTCCTCC
CGCAGAGTCCACCACCACCTCCCCCTCCAGATGAGGATGAAGACGATGATCCAGAGCTAAATCACTTTACCTTATATGCCCCCACTGGTGATATCCGGGC
CAAAGCGGGTGTTACGGCGGTGCAGCAAGCAACCCCGACAGCGCATGTGCGAGAAAATCGTCCAATACCGTCAACACCAGCCGACCGATTCAGAGAGATT
GAGAACCACGTTGCTTCGCTTCGTTTCGTCCAACCTGCTGGGACACCAACCATCGCTGCGGCAAATTCCCCAGCAACCGACGCAGTACACCCAGTCTCCG
CTAGGGTTCTAGCTACTCATCAAGATGCGGTATCTCGTACTCCCCCTCCATACATCGAACCGATGTCCATCTCATTTGATGCTGGCCTCCTAGCTGAGGA
CGAGGATATCCAGCGTGAGATCGACGAGTTTGTGCGTAGCTCCCAGATAATGCGGCAGGAAACCCGGGCTGCAGTGCAACGAGCCAGCATAGCAAGAGAG
AACGGGCTAGTGCTGCGTCTTCAGCAGGCTCAGCGTCAGATACTTCAATTGAAGGAGCATATCCAAACAACGGCAAGGAATGAGCCACCAGCGCTGGAGC
GTGGTAACCATGCAACGTCCGGACACATTGATGTGGACAAAGATAACGGTGATCAAGCCTCCAAGGAGTTGGCCGCGGCGAAGGCAACGTCGGGTGTTTC
TCAAGTTGCCTATAGCAAGCTTCAGAAAGAGATCAAGACTCAGGACACTTTGATCGCGGCTTTCCAGAAGGAGAACGAGCGTTTGATGCAGCAGCTGAAG
CAAGTTCGCCAGGATGTCCAGTATGACGTGCATGAAGCAAACGAAGAGCTACGTCGGCAAATCAAGAAGCTTCAGGACCAAGCGGGCGAGGCTGCTACCA
TCGGTGTCGGAGGTGATCTCACAAGTAAAGCTCAATACCGAGTTGCGGTAGAGGCTCGGTTAGAAGCTGAAGCTCACGCTATAGCCCTGCAAGAGGAGCT
TGCTGGAGTTCGGTTATCGTACCAGCAGAAGCTGAACGAGATTACGCTGGAGTTGGATCGAGTGAAGAAAGCCAAGGTCGAGCTGGAGTGTCGCTATGAA
GGTGTAGACCTGACCCAAGTAGCGCAGGAGGCGCAGCACGCTCGCGAGCTTCAGACCGAGCTAGATCTGGGCAAGAAAGAGCACGCGCATGCGCTGAGCG
CATTGCAGAAGAAGCTTGACTGGTACGTGGAGAACCAGAGACTTCTCGATGATCAAGATGAAGAGCTACGAAGGCTGCGTCGCCAGGTCGCAGCTCAACC
CCCCGAAGTTCCAGCAGAAACACCGTCTAAGGAAGAGCGACCCAATGTCAAAGCATCGCCTGCTCGCCCGCATCGTCGGTCACCGAACGATATTCGACGC
ATTCAGGAGCTTGAAGGTCGTCTCGCGGAGCTGGAAGAGGCTATGCGTCGTCGACACCCCGACAGCTTGGCCAACCTCATCTTGGCTTCTCGTCGTGCAG
ATGAAGAATCCAAGACGCGCGCCCTAGAGCGTGACTACGAAGACAAGCTCGAAGCGTTGTCACGCGAGCTGGAGCAAGCCCACGAAGCCAGTGAAACGAG
GTTGGCGAGCTTTCGTCAGCAGCAGGAGAAGTTGTTACTGCAGTATCGACGCAAGATCAAGGAGCAAGAGAAGCAGCTAAAGCAGCTGAGCAAGGCTCCA
CTATCGCACAGAGCTGCGTCCAAGGACTCGACTGGGACTTCAGACGCAGAGCTGGTCAAAGTACGGCGGTTTTATACCGACAAGATCAAGGAGCTGGAGC
GCAAGTGGGAAGCCAAGTATCGCTCACTAAGGAAGCAACAATACTCTGGCCTGAGCAGCAACCAGCAGGTGCAAGACGGACTCACGTATGCAGATTCTAC
CCTGGTGATTGCCAACTTGCAGCGTCAGATTCGAGAGCAAGAAATGGAGCTGAAGCAGGAGAAGGCGAAGGTGGAACAACTCGAGGCGGAGAGTCAATTG
CCAACCCTACATCCAGAGGACTCACCAGCAACGAACGATATCCCGTCCAAGTCCATACGACCAGACCAGCAAAAGGAGCTCGAGAAACAAATCGCTGACC
TGAAGTCCCAGTTAGAAGACAGCGAGAGTGCTCGAGCCCGACTAGCGCAGACGTTGACTACGGTTCAAACTCTGGGCTTAGCGCGAGCACTGAATTCTGA
GACCACGTCAACCGCGACCGAGACAGAGGCTACCAAAGTGACTAAGCCTACCATATCCAAGGACACTGAAGCTGAACTTTCACAATTGAGGCAAGACCTG
GCAGTAGCTCGCGAAACTCTCGGCACCGAGCGAGCCGCTTCGACTGAGAGAATCATCAGGCTTGAGAAGCAGATCACTGAGCAGATCGAGAAGAACGCAG
TACTGGAGGCCCAGTTAACTGGCAACCAACGTGAGATGGAAAGCCTTCAGACGCTGGCACTGGAAGCGGAGCGACACAATCGAGCTCTGGAAGCTCAGGA
GCGACGTGTACCGGAACTGGAAGAAGAGGTGCTAGCCTTGCGTCGCGAGCTGGAGCTTCCCCGTACGCCGTCCATGGTGCAGTACCGGTCTCTTGAGCTC
AAGGTGGCGACGCTGGAGCAGAAGCACAAACTGCGCGAGGCCGAGCTCAAGGTGGTGCTCGATCGAGCACTGACATCGACTCACCTGGAGCAGCTCAGTC
GCGAACGTGCCCATCGAGCAGCCATGGCCGCCAAGAACGCCGAGATCGCGTCTTTCAAGCGCCAACTCGAGGAGATCCTCGACGAACTCGCACAACTGCA
GCAGCCGCCCTCGTTACGCGCAAAGAGATCCAACCAACCTGAACAAAAAGAAGAGGGGGAAGAAGATGTATCATGGTAATCTAAGCGAAGAAAAGAAAAA
AACAATGTTGAGGCATTCTCCTGTTGGCAAAGCATCTATTGGGGCGTGCGGTTAAATAGCAAAAGCACGGGGGACCGGAGCTCTCGAAACCTCCAGCACA
ACCAAGTGCGAGCGAATGAAGCACCGCGCGTAATGTAGCCTAGCTCTGGAGCTGCTCCTGGTGCGTCGTATCGTATTCTTGGCCCTGCGTCTGCTGCTTG
ACGGCTCCCTTGTCCTCCCTGCGTCCAAACCTTAACTGTGCGCTGCCTTAGGTCATGGAGTCGATGAGGGCGCTGCGCATGGTCGTGGCAATGGAGGCCG
GCTGCGCGTTCTGGAGCTTGAAGATGCTCTCGATCACCGAGATCTCGGTGGACGTCGTGTCCAGGCCGCAGAAGGCCGTCCAGTCGTTCACCACGAGGCC
GGCGCCGATCACGTCGCTACCGCGGTTCACGGTACCGGCCACGACGGGCACCTGCAGCAGCGAACTGAGCTCCTCCTGGTCCTCGACGCTCGTGCGCGGG
TGCACGAGGCAGCCCTGGTTGGACAGCGCGCTGTAGCTGCCCACGAGGGCGTTGCCCGCCACCGTCTGGCGGAAGACCTCGACGCCGAGCGTGTCGGCCA
CGATCTCCTCCGTCTCGCGGTCCAGGTCCGTGTGCACGAGCGCCACGTGGTCGTTGGTGGCGATGCAGTTGCCGAGCGCCGAGAGCCGCTCCTCCACGCG
CTGCACCACGACCGAGTCGGGCAGCGAGTTGCGGATGTGCTGCATCTCCTGGTCCGTGGTGGTGCTGGGCAGCAGCAGGCCGCGCTTGTTGCCCACGGCC
ACGCGGCCCACGAAGCGGCAGCCGGCGATGCTGGCGTGCACCACGGGGATGTGGTCGGCCAGCTCCGACTCGAACGTGCTGTAGAAGTTCTCCGAGCCAC
CCACGCACACGAGGCAGTACGAGTTGGTGAGCTTGGAGAACACGCCGATCTCGTTGCTGTTCTCGAACTGGCAACGGATAGCCATGGCTGTGTGTGTTGT
GTGTGTGTGTGTGTGTGTGTCTTGGGTGCTGAGGGTTACGGGGGGGGGAGGGAGCGCGACGCGGGTGACTCGGGAGCTCCTGATTGACAAATGGTCGGAG
CTGCTCGCCACCAACGACCACCAACTTCCCCGCTTGATACGATTCGGAGTTAGCAGAAGCGGAGACCGAAAAGATTGTTCCGAGAATACGACTGTCCTGA
TGAGACTGTCTTCCTTAAACTGTTTGGTATTTGTGAAAGGGCGGTTTTAAACGGACAGAGTTAAGACCAGCACTCGTCTGAAGCACCATCATTCTGAAAA
AGGCAACATGTGCTGGGGCTGCTGAGGAGGACGCAGGCATAGCTCTGAGAATTCTCCTCTCTCGTGGAGCTCTGTCAAGTTTGGTCGGCAGAAAGCGGTC
GCAGCGTGCAATGTGGACGCTAGGACAGTAAAGCGATCTGGTGCTCCAAGATGATGGCGACAAGTGGTGCGAGGTTCGCACTGCGACTCAAGCAAAGGAC
TTGAACGATGGAAAATCAATCGAGCTGTGTCTTTTTTTTAACAAGACATAGCTCGATTGGTTTTTAAAACAAGACATAGCTCGATTGATTTTCCATCGCT
TTTAAAAAAGCTTGAAAGCTTATAAAAAACTACATGCATTGAACGCCAATAAATGTTGGGAACTCGAGGTAAATTAGGTATGCGTCTCACATGTTCTTCG
AGTAATTTTCACTTTCAAATTTCAACGCCACACGTGGAGGAAGCAGCCGTGCAACCAAGTCGTCAAGGGTGCAAACCGAACTACCGTACCCCACAGAAAA
AAACGTCGTTGATCTTTCTCGTTTCGTACTCAACTTACCGCTAAAAAAACTCTCATTTTCTTCAAAACGGTTTTCTTCATGTAGTTATATGCGTTTTGTT
TCGCTAAAATTGTGGTTTCTTAAAGATTTGCCTGAGAGCTGGAAATGGTAATCTAAGTACTTGTATTAATAATATAGTAATAAAATGTTATACCATCTTT
CTGGGAGGTGCGATAGTTGAATTATGGACCCCTCTACCGTTTCTTTAGAAAAGTAAAGCTTGAACCGAATTGGGATCTACATTCAATTTATTGCATACAA
TACAAAATAAGTTCAAAACCTGGACGGCAACAATTTGTTTCAGGGGAAATTGCAATTTGGGAATTTGCTAATGACCAAAAGTCAGGACTTCTGAAAGTTA
GAATTTGCACTGTCCTAAATGTAAGAATTAGAACTTCCAGATTGGTGGTGAGCATCATGCTGGTAGGTCTGTTTCCAGTATAAGCCTGCTCTCGGCTAGC
AAAACGTTATTAATACAACATAAAGCACAACTGTGAGTCTTACTCTCGATTCCCCAGCAGCCACCAACACGGCCGGGCAATAGATTGATCTGGTCTTGCT
CGTGGGTTCCTTGCTAACTGTAAGTTCAATGCATATAATGTCTCGTTGGCCACAAGAACTGGCTGTCTTTTGTTCTCATCTAGCCCAACGCAAGGTCAAC
CTCTCAAGTTAACCGAACACGAATCAGGACGCGACGTTTGGTTCTAGTATTGTATTAATAGTGTCTTCCAGATCTGGCGTGCAAATCTGAAAGTTAACTG
ATTAGCAAATTCCAAGTACCAAATTCCAATTTCCCCAAAATGTTTTGACAAATTGGAGCACCATCATGAAAAAAAGGAACATGCGACTCACCCTCACCTA
ATCTGCTGAGGACGGAAGCAACCGCTGTCACCTCCTCTTATCGCGTGTGGTCGGCAGAGAGCGGCGTGGGTCCTTCAGTTTCTGAGGCCATGCTGTAGAG
TAAACGACTTTGCTCCGCGCTCGGCACTCTTCGACGGTCGCTCCCAGGTCGAAGGGCCTGCAAGGCGAAGCCCGTCGGATGACCTGGTTGAACCCTCGAT
CACTCTCGGCGTTCTCAATGGAGGAGCTGGACTTCATCTGTTCGTCGTGCGTGTGCGATGCGGATTCCGACGGCCGCGACAACCTGCCGCTGCAAGACGA
TGGCGACAAGGTGGTGCGAGTCGATCAACTGCGCAAGGACTTCGACGACTGCTGCTCCTGCGTCTTCGATCGCCTCACGTACATGTGGAGGAAGAAGACG
TTCAACCACTGGCGACAATTTGTCAGAGGTGCCAACTCAGCGGATGCTGAACAACGTGACCGCACGAGATCAAGAACCTCGTCAGTCAGCAGAAGCAGGT
GCGGCAGCTTCATGGAGACGATCGGCGACGGTGTGAGCAGCAGCAGGAACGTGCTTCTGGACATCACGCCGGCGCTGCACCTCGTCGTGCGGTACCTGCA
CGTCGACGACGTCTACCGCCTGATGATCACGAGCAAGTCCATCTGCCATGAAGTTGGTCGGGCCACGCATGCGCTTTCGTTCATTCGAGCGCGTCGGGTG
ATTGTGGACGAGCACTTCAGCACCCTCCCGATGCAATTCCCCAATTTGAAGGAAGTCAACTTGACAGGCTGTTCGAACCTTACCGACGAATCCGTTGAGC
AACTTGCCCAGATCCCCAGGATGGAATCGATTGCGCTCAAAGGATGCTACCAGGTCACGGACAAAGGGATTATCGCGTTGACGGAATCCCTGTCGAGCTC
ACTCACGTCTCTCAATCTCGGATACTGCAAGGTCGTGAGCGATGAAGCTGTGTCGGCCATCGCTGCTAATCTCCCGAAGCTAAACTACCTGAGTCTTCGT
GGCTGCAGCCAGGTCGGTGACATTGGTATCCGGGAGCTAGCTCGGCTCAAGCACTTAACGACTCTAAACCTCTGGTACGCTAACCAAGGTAACCTTACGG
ATGACGGAATCTCCGCGCTCGCAGGGGTAACGTCGCTTACGAGCCTCAACCTGTCGAACTGCAGTCAGCTCACTGATGTGGGGATCAGCTCTCTCGGCGC
TCTTGTCAACCTGCGACACCTCGAGTTTGCCAACGTCGGTGAGGTGACGGATAATGGTCTCAAGGCGCTAGCTCCGCTGGTGGATCTCATCACGCTTGAC
ATTGCTGGATGCTATAATATCACGGACGCGGGCACCAGCGTGCTGGCCAACTTCCCCAATCTGTCGAGTTGCAATCTCTGGTACTGTTCTGAGATAGGCG
ACACGACATTCGAGCACATGGAGTCGCTGACCAAGATGCGATTCCTGAATTTCATGAAATGCGGCAAAGTCACGGACAAGGGACTGCGCTCCATCTCGAA
GCTTCGCAACCTGACTTCTCTGGACATGGTTAGCTGCTTCAATGTGACGGATGATGGTCTCAATGAGCTTGTGGGGCTGCACCGACTCAAGTCCCTCTAT
CTTGGAGGCTGCTCTGGCATTCGGGATGATGGCATCGCCGCACTTTCGCAACTGAAGTCGCTGGTGATTCTTGACCTCTCTAACTGCCGCCAGGTTGGCA
ATAAAGCTCTGCTCGGGCTGGGTGAGCTGCACAACCTCACCAACCTCAATCTCATGCGCTGCAACCGGATCGATGATGAGGGCATCGCGTACCTTGCAGG
ACTCAAGCGACTGAAGACGCTCAACCTGTCCAACTGCCGTCTTCTCACGGATGCAGCGACCACGACGATTGCTCAAATGACAGAGCTTGAGTCGATTGTG
CTTTGGTACTGCAACAAGCTCACAGATACTGGGGTCATGAACTTAGCGTCTCTCACGAAGCTGCAGTCGATCGATCTTGCGAGCTGTTCCAAGCTGACTG
ACGCGTGTCTATCGACGTTCCCCTCAATACCCAAGCTCACATCGCTGGATCTTGGGAACTGCTGCCTCCTCACGGATGAAGGCATGGCGACTCTGGGCAA
GGTGACGTCGCTGACTTCATTGAATTTGTCGGAATGCGGAGAAATCACGGATGCGGGGCTTGCTCACCTCGCGGCACTCGTCAATCTCACGAACATTAAT
CTCTGGTACTGCACAAAGGTAACCAAAACTGGCATTGACCACTTGCCGGTGCAAGCTGTGGACTACTAGCTCTGTCGTCCAAATTCGTAGCGTGCGAAAC
ATAAATGTGGTAGTGTTTTTGCGTTGTACAAGTACAGTAGTAGCGTGCCAAAATTGCGGTAATTCATTTGTTCGTTGTTCTTGCTCCTTCCGACGCTTTC
CTACGAGCCTGTCGTATTCCTTTCCCAGTGTAATGCCGCTAGAGTGCCTTCGTTTATGCCCCACGACGACGAGCAAGGATGGCAGCTAATTCGCTGTTGG
CTCCACCGATGCCTCCGTTTGCAGGGGAACTTTGAACACTCTCGCCAAACTTCCGCACCGATTCCATGGACGCCTTTGCAGACTTCCTGTACGTAAGCGC
ATGCTTCCGAGCTTCCTTCTCAGCCTGCTTCTTGGCTTTCTTTTCAGCGACGCGGCGCAAACGCTCCGCTTCACGCTCTCGGCTGCGCTGCTCTTGGCGC
TGCGCCCGCATCGCCAACTCTTCCTCGCGTTGCCGTTCCAGTTTCTTGCGGCGTGCCTTCTCACGTTTGCGGCGCTTGCGAATGTACTCGTCAGGCACTC
CTGGTGTCACATGAATCTGTACACTGTTCGCGTCGCCTGTAATTCTGTCGTGTCCAGCCGAAACAAACTGAATCTGCTGCGATGGTGTTTTCGACAGTCC
AACACTCGCGGCGCGGCGGAGACGAATAGAGTCACTGAAGCTGATCGGAGTTGCTACACTCGCCAAGGAGCGTATTGCGTCCACAAGCGTGACGGCGATC
TCGGTTTTCTTCTCCGATAGAAGGAGCTGGTCTTCAGGCATTTCCGTAGACATGAGTCCAATCACCTTGTCATACACGCGGGACGGCGTATAGAATCCAA
GATCGGGCACCACTTCCAGCTGCTTGCAAACATCGTTGCAGTAAATCTTGCCAGTGTATCGGCAATGGTGGCGGCGGTTGAACAGCCCGAACTTCTTGCC
GGTAGACATACACACCATCGTAGATTTATTGTCCACCCAGTTGCTCTTGTTAGGTTCAGCAAGGAGCGGTTCTTGACGCACTTTCAATACGAAGTACTGA
TCAGCCATTGTACTCATCGTGATTTCTTCAATAGCGGTCAACCGTAGACGACGACGAAGGTACACCAAAGGAGGCACAAACGTGCTCTTCGGATCCACCA
CAGGCTGCCACGTACGCTTCTCCATTAGATACAAATACTGGTCCGTGACAATCAGAACCCGTCCTGCCAGCGCAATTGGTGATCCGTCGGGAGATACTCC
AGCAATCGGACAAGCCTTTTGAATCTCATCCATAAACACAATCTTCTCGGAGTCGCCATAGTGCTGGATAATCCCCATGACCGCTTCGCGAATAGTACTG
TCTCGCAGATAGTCTCCGTCGAAAGGGCGGTAAATACTCACGCGCTGACGTTGCTTGTTATTAGACGCGTACAGCTTGGTGATGTCGTGGCTGAGCTGCA
GCAAATGACGACGGCCATAGTACTTCTTCCACGCCTTCTGAATCCGCATCACGAACGAACCAAGCTTTTTCTCTCGCAATTTCTCCAGCTCGAAAAAGGT
TTCGGGTGTCTGGATGAACACCATTGTTTTTCCAAGCTGAACTTCCTTTTCAAGTTGCGGAAGCGATTTTACAGCAGCGCGCAGAACTGCTTGGGTACCC
TTCTTATCCGATCCACGGAACTCTGGGTAGGTCTCCTTGCTCAGCAGTCGGAAACGATCCACAAAGCGGCCATAGTCTCCACGGTAGGCGTAACCTGCAC
GGCGAACCTTGACGTTCTCAAGAAGACCAAGATACTTGATCTGGTGTACCACGCGACGATCATCCATCTTGTTGGGCTGTTTCTGGTCGTTGGACTTGAT
GCAGCGCACGTAGTGAGGTGTGCAGTCCATCAGCGCAGTGACAAGAGCTTCACATTGAGTACGGATCTTGTATCCGGCCGTGTTCGCCATCCGTTTGTCA
TTCAGGTCGATCTCCTCAGGGAAAATGTAGCGCATGAGCTTGTTGGACGTCTCACTGATGATGAGCGCGATGTCCTTGCTCAAGAAATCCTTGTTCGAGT
CTCCAAAGCCGTCAATGTTGTACTGCACGTCACCTGCATAGTGTTTGACCTCGAAAGTCTTGCCACGCTTGGAGAAGTGCGGATGGGACCCATGGATCCC
TGCGACCTTCTCCAGGAAATTCGCATCCACGCTTTCTCCCTGTCGGGAGTGCATCGTTTTGACTGTGTCGTCAAGAATGAGGAAGATGCCGGGCGTAGGG
CGACGCGCTTCGATCAAATCGCACACGACCTTGTTGTTGAAGAACGGAATCGGTGACCATGCGATGCCTTCGCGCGCGTACTCCTCCTGCTCGCTCTTGA
GCGTAAGTTCGATGAAAATCTGCTGCAGCTTCTCGTTCACGTAGTTGATGCAGAACTGCTCGAAGCCGTTCTTGTCGAAGATTTCAAAGCCGTAGATATC
CAGAATACCGATCTTGGTCATGTCTTCAATCTCCAGGATCTCGCCATGCTTCTCCGCCTTCTTTTCAATGTCCAGCGCGTGGTTCACGCGCTCCACCAGG
AAGTCGAACAACCGGTCGTACACAGCCTTGGCAATCGAGTCCCGCTGCGCCGTGGCTTGGCTCGTGTTCTGCGGCACCTCGTACGACTCAATCTTCCCAC
CAGGCGCCATCGTCTGCAGCAACTTGTAGCACAGAGCGTGCTCCACACGCGCCGCATCAAGGCCCAACAGTTCACACGCGATCTTCAAGCTCTCGCGGTC
GCGCACAGAAGAACCTTCCGCATCCCCCACAGTCTCCGGCTGGAAGTGCACGTTGCCAATGTGCAGCACCGCCGCCAGCGTCTGGATCACCAGCTCGATC
TGCTTCCGTTTGATGCCCACGTGCTGCATGGCCGCCATGGTCTCCTCGAACTCCTGCGCATCGTTGACATCGTCGACGTCATAGCACCCACTGACCTTCA
AGTAGTGGAAGCTGTCGGGCCCGCCTCGGTCCAAGTAGAGCTTCTGCTTGGCTGCGGCCGGCAAGCCCGCCAGCACCTGGTAGAAGATGTGGAAGTTCCT
CTCTCCCTTGCCGGGCTTGACGACGCGCGACTTCTCCAGCAAGTAGTTGGTGACCTTGCCACCTTGCGGCCGGCCCGCCGAGTCGAAGAGCAGCTCGAAG
TACTTTCCGAAGCGACTCGAGTTGTTGTTGCGCAGCGTCTTGGCGTTGCCAAAGGCCTCGAGCAGCGGGTTGCTCTCCAGGAAGGTGCGCTTGACCTTGT
CGACGCCCGCGCCGCTGCCGCTGACGCCCGCGATGTAGTTCTGGATCTGCTTGGAGGCCTCGGTCTTGCCGGCGCCGCTCTCGCCGCTGATGATGACGCA
CTGGTTGTCCTCCTCGCTGAGCATGGTGCGGTACGTCTCCTCGGCCGTGGCGAACACGTGCGGCGGCACGTCGACGCGCGCCTTGTGCATGTAGGCGTGC
ATGCTGTCCTCGCCGTAGATGTCCAGCCACTTGTACGGGTTCACGACCACGAGCACGTGGCCGATGTACGAGTAGATGACGTCGGCGGCGTGGCGCATCT
TGAGGTTCTCCAGGATGGACGTCTCGCTCACGGACGGCAGCAGCACCAGGTCGTCCACACCCACGACCACGCGCTCGTCGCCGAACACGCTTGCGTGCTT
GGCCGCAGCGGCGGGCTTGCGTCGCCCCATGGTCTGCTCTCGGTCTCCGTCCGAGGGTGAAGTTGCTACAGCTGCTTGAAGGGCGAAGTTCCCAGTCTGG
GGGGAAATCGAGCGAGCGACCCAGCACGTGAGACACTGTGGCCGTATCTGCCTTTTCATCCGGACCCGGTCTTATACTAGGCTTTGTATAAGGTCGGACC
CCTGGGACATATTCGAAATAGAGAGGTTTCGCAAAGCAACTTGTGGGAGTTAGCGACAATACATTCCCTACCCCTCTATAGAGACGTGTGTCTACAAGTT
GTTCTCGACTCGTCTAGAACGTCTACAACGCCCTGTACACGTTGGTACTTGAGGAGATACGGGTAAGCATTTTACAATCTCCCAGCAATCTTTACTATGG
AGAAGCCAAGCCAAACGCTCAACAACCCCGTGGAGGAGGCCCCACCGACGAAGCGTCGTAAAACGATGGCCCGCTTTACGGATGAGCTTGACTTCCAACT
GATCCAGAAAGCTCAAGCAAGAAATCCGTATGGGGAAGACTACGGGAAGAAGACCCAGGCTTGGGCTGATGTAGCTGCAGCTTTGGAAGTGGACGTCGAC
GGTCGCCGTTGTGCAACCAGCTCGTAGATGCGTATGAGGCAAAGCAGAAGGCGAGTGAGAAACGAAGCGGGCCGTGTGAAGAGTACACCCCGAAGGACGA
ATGTCTGGCGGAGCTGCTGGAGCTGCGCGAGATAGAGGCGCTGCTGAAGAACGACAAGAAGCAGCCGAAGGACCAGCAGCAGCAGGAGGACGAGCAAGCT
AGCGCTATGCGCGACGCAGCCTTAGAAGGGATGAGCCGAGGAGGAGGAAAAGGTGGATCGCAGCAGCAGCAACTGGTTGCTTATCTCGAACGCCGCGACC
AAGTCGCTCAAGCACTGGAAGGGAGGAAGGTCGCCAACGAGGAGAAGCGGCTTGCGTTGGAGGAGCGACGCCTGGAACTGCAAGAGCTGCGAATGGAACT
TGAGCGAGACGAGCGACTTGCGTTTTATTGAAATGTTAAAGGCTGTCGTCAGCAAGAATAGTTCGTAGTAGCTAGAGTAAGGTACTCCTCGAGGCTTGGC
GGCTTAATGGAAAATAATTTGCTGATCTGGTTGGGGTTGGAACAGTTGCGGAAGTTTGTCAGGAGTACACCGACCAAGTAGTGTTTCCCCACAGGTGATA
GATATAGTCTTTGACTCAGTCTCAGATCAGGAAACGGCCATAAGCGAATGATCCCTCTGAACCCCCACTCCACTGCCACGCGAACTTTACTCATAGCCGC
ATTGAATGCCTTTTGCGTATCACTCAGATTGGAGCCCTTGAAACCGACGTGCAGCGTTGGTTTGAGTGGGTAGGCAGGATCCCCATAGATGCAATACGGA
AGTTCCCCGTCGTGATGTAAGACACGCGGAAGGCGCTCCAGCAGTCCACTCTGCCTTAAAAGCCAAGAATCGTGACGACGTCCAACCGTAGGACCGTAAA
AGTCGATGAATAGTCCGTCCGGCGCCATTACTCCTTGGTATTTTAGCGCGTGTTTCCTCTTGTGTCCGTTGTAAACTTGTTTTTGGTTGCGCGTTGGGCG
TGCAATAGCACGCACAGTGCCATCGATAAAACCAATGCATCTCGGCTCCGGTGCTCCACGTTGTGCCACAGCAGCAGCGTACTCCTCCAATCGCGACGAT
GTAAGTAGCCCACATTCAATGGTGAGTAGGCATTTGTACTTGTCGTACACCAACCCCAGCATGAAGTTAAATATCATGCAGACAATAGGGGCGGACCGCC
CGAAAAAGCGGCTTAAGTCTCCATAACGTCCCGGGTATGCCATGCGGCGCAAGAGAATTCAGAGGCCCTCGAAACCGGAGAAGACAGCTCGATTTGGGAG
TTTATAACTACTGTCTGGGCGAAGCGCTTCAAAGAGTCGAAATAGGTCTCGCTTCCAGAAGCGAAAGTAGAACCGTGTTTCGTAGTCGTTGAGCGCGTTG
ATGTTAAAGCGTTCGCCGTAGGAAATGGACCGGGGAGCGTTGCTTGTGGACGACGTTCGAGCAGAGAGGAGACAAACCGCTTCTTCCTCTGAGAGCATGC
CGAGCACGAGAAGGTCTTGTACGTAAGTAGAGTTCATCTTTGAAAATGCTACAGACGTACAAGTCTAAGTTGCGAAAGCTCGTTCTAGAACTTGGCCGGA
TAAATCTATGGCCGCTCTCTGTCAAATCTTTCGAACGGCTCTAACTTCCACAAGTTTAACTTGCGAAACCTCTCTAATACGAGGGAACGACGGCTTGCAT
ATTAACTCGACCTCCCTCCGTTGCAGATAAGTCGACCACAACTTGCATAATTACTCGACCTCCTCTCCATTGCAGATTAAGTCGACCCCTGACTTGCATA
ATAACTCGACCTCCTCTCTATTGCAGACTAACTCGAACATAGGATCAAACGTAGGGCAGATTCGCGGTTGGCAAAGAACAAAACTGACGGAGTTTATTCA
ATCACAGTTACTGCAACCTTATCCTTCTGTAGTGCTTCGAGTAGTGCCGAGCGCGAGCGTCCTGCCTTAGTCACATTGAAGCTGCCGCTTGTAAGTGATT
TCATCTTCTCCGCTACTGAGTCTGGTCTTCTTTCAGAGATGAACCGGGCTACTTTGTGCATGTAGTGTAACATGTACACCCCGCAGTCCAATGAATTCGA
TTGAATAGGGCTTGTCTTGTACGCTAACAGTTGTGGCGCCACACTGGTTTCTCTGCCACATCGTTTCGCCTCGCGAGCTAAAAACCACATCAGCGTATCC
AAAACAGACGCCGAGTTGTGATAACCGCGTAGCGAGTTGATGTGGTAGCAGATCGTTCCAGCAGGTTTCAGCGGATTCTCAATGATGACGAAGCTGTAGT
GATCTGCACCACTAATAGGCAGTAACACAAACTTGTGTGCCGCCCAGTCAAAGCTACCGGTCACTTCATCTGGAACATCTTCACCATCTCTTTCACGGCG
ATACACGTTTTGGATCTCCAGATAGAACGAGGTCCCAAGCGGTAAAGCCAATCCGTCCACCTTAATCATGTGCTTGTAAATGAGGCAATCTACCACGCGA
GTCGTCAGCCATTCCCCGGGCAATAAACTGTCCAAGTCTTCTTGGTACAGCGGAATTCGAATAATTTCACCGTGCTTGTTTCCTGCACGCTGGTGCACCA
CAGTCATAATTGGCTCGTCCCGATTTTTTCTTTTAGCGATCCTTTGGGGACGTGCCGTGCCTTTCGGCTTATTGCCTGACTGGGGTTTAACTTGTTCTTG
GCTCTCTTCGATAGCCGCATCGCCAACGTCCTCCTCGCTGATATCAGACCCGTTTTCAACGTCGTTATTTCCGGAATTCCCGTGCAAATTTTTTGTGGCA
CCCGAACCCTTATTTACGGGTTTGTTCGCGGATGGCTTGGCTGATTTATCGTTGCTTGAGTCTTCACTGGGGCCATTTTCGTCTTCACTTGCCTCGTCGT
CTTCACTTGCCTGTTCGTCTTCACTTGCCCTGTCGTTTTCACTTGCCTCGTCGTCATCACTTGCCTTGTCGTCTTCACTTGGCTCGTCGTCCTCACTTGG
CTCGTCGTCCTCACTTGGCTCGTCGTCCTCACTTGACGACACACCCCCACTTGGCTGCCCGACCTGGCTTTGCTGTCCCGTTAAGCTTGGCTGGCCGACG
GGTTTATTCTTATAATTGTTGATAAAACGTGATATCCACGACTCTTGCGTTCCCTTCTTCAGTATTGCGAACTCAGGGATATTATTTCTCGCGTAGCTTA
GAAGCTCGGAGAAGGTGCACGTGCCGCCATCCTCGTGACACGAATCATATAACTTAAGGACGCGTAACTCGTAGGTCTTAAGGCGCTTCTTCTTGCCGGC
CCCCTTCTTGCGAAATGCATCTCCAAGGGCTTCCAAAGCAGCAGGATCGTCCAGCAGATGCCACAGCGCCTTCTTCCAGCCCATCAACGTCCCCTTCGCT
ACACCAAGCTGCTTTGCAGCCACCTTCGCAGTCCACTTAGGGTTATCTCTCCACTCCTTGAGCTTGCTGACCTTCGTGGCGATAGGCACTTGGTTAAGGC
GCCGTCTCTCCTTCTCCAGTGAGCGCGAGGTCGTGTATTTTTCCAAATGAGGGGAGTCGAAATGAGCGGTGTAGATTTCGTGGCTTTGTTTACAATCTGT
CGACCAAAATTTTAAGCCAGGAAACTTATAAAGTACGATTGATGACTAAACCCTCGAGCCGGTCGGCTTATACTGCAAGTAGGTCGAGTTATCCTGCAAG
TAGGTTGACTTATACTGCAAGTAGGTCGAGTTATACTGCAAGTAGGTCGAGTTATACTGCAATACAGGATGTATATGGATTTTGTATGTATGTGTGTTAC
AGTGACTTAGAAGCTCTTACTTGCCTTACGAATTCTGAACGACTCTACGTACGATCTTTCCGAATCGATTGAGAGATTCTCCCGCCTCTTTGCGCTTCTT
CTCCAGCTCTCCAGCAGCTGCCCCTTCGGTTATCTGATGTTTTGCAGCAAATGCCTGGATCGCATCGTAGAATACCTTACGACGTGAGAAGAACCGATTC
TCTGTCGGATCTTTTCGCCACTTGCTTCCAAATCGTTGCTCAGCCTCGCAGACGAACATTTGACCAGCTATTCCACGAGTATATTCAGTCCACACTTCAT
TCACTGTCTGCAGCGAGCGACTTAGACGCAATTCAGATCTTGTTGAGCGCTCACCGATTGCCTGGGAGTCCAATGGCTCACGAGCAGCGACAACACCACG
TCGATGGGGAGCATCAACGTCATCTGCCAATGAGATTACAAGTTTCTTGTTCGCAGAAAATAATCCTTGTTCTTTCAGCTGTCGAACTTCACTAACGAGA
CTGTCGATTTTCCCGTGATGTGCATGGAATCCGTCTTTCATTGTTGATGCAACTAACGGAATTGCAGCTTCGATGCGTGTATCCTGAGGCTGGGTAGTCG
GTTGCAAAGATATCGTGACCTCTGTTTCAAACTTCTCGTAAGCCTCTGTACTAAAAAGCGGGTCTCTCCACAAGCAGTGCTCCGGGAACTTTCGACGTAG
TAGTACCGAGTCCTGGAGAAACACAACTCTCAATACGTGTAGCAACCCTAGAAACCCGCCTGTCGCTATCTCCCGGTTTCCATTTTCCTGAAGATCGTCT
TCAGCGGAGCCTAAATCAGGGAAAACCATTTTCTGGAGATCTGGTGATGGTGTGATTGTGGCACGGTCAATCCAATAACCAACCCCTTTCGTAGGGAAAC
CAGCCAAAGCGCGCATAGCTTTTCGGGGAAGTGTAGTCAGGTAGCATGCCTCCATTCGTTCTCCATTCCATCTACCAGCCCGTCTAATCTGGTTTTCATC
CGCACCTTGTAGCTCAGCCAACTTAGCGCCTGAACCGCGGTTGGCGTGTGTCCAAACCGATGAATCAATGCCGCAGGCAGTGAACGCACTCTTCACGTGT
TCTAGTTGCGTGTTGTAGGCAATATCACGTGTTGCACATTTGCCTTTCAGCAAACGGATGTCGTACCACAACTTTCGGTCCGTAAAGCTAGGAAAGGGCT
CCAAATCCACATGCCACCGCCAAAACAGGTACAATGCCACAGCATTTAACGGGCACAACATAACATCTTTGCATCGCATCGCAGCTCCATACTCTACCCG
CCCGACTTGATTTGATTTGCCTTTTCTCATAATGACCACGAGAGGGCTGCATACTTGGGGGCCTTCGTCGGTTAGCTCTAGCGACAGCATATCTGGAAAC
TGAATAAATCTTAGCGATTCTCCGCGAGCTAGAAGAGCGTGTCCAACTAGAAAGTCCACTTGACTTCGTAAAGCAACCCCTGTAGGCTGCTTGAGCCATA
ATTGGCTTAGCGCTCGCATATCTTCCAGGTTGTAGCCGTCTAAAACGGTTCCTAAACCACGGTCAGCGTATGTATCCACCTTCCGCTTGTTCTCTCCACG
CTTCAGCATGTCCATCAAGCCTTTTAAAGCCTTGCCACGCGGGTGGGAGTGCTGATTCATACCAATAGACTTCTGAAACTGATACAAATCGATTATAGCC
TTGACGTACGCGTCCACCGCCTCATATCCGAGTCGGACGGCACTTCCATCGTCGTTTTTCTTGCGCAGGTTTCCTCGGGGTACCACAAAATTATCGATAT
AGTCTACTAGCTTCGACTCGTACACCAGCTGGCAAAGTCATCCTGCTTGTTCTTGTACTGCTTTATCGTGTTTTGCGGTCTTGTGCTAGCGTGTCGCGTC
ATCACGTTCACCACAGCTTGCTGCAGCTCGTTGGCATTGGCCGCATCGGCCGGTAGCGCCCCCGACATGCCGGCTAAGCGGCAAAGCGCGCAGAGGTCCG
GGAAGGCGATACGAAACTGCGGTATGACTGAACGAGAAGAGAGGGGGGGCTTCTTCTCTACCATACGACTGGCTCTCCCGCTGTATGCATTTTTTGCTAA
GTATGGATTATTGAAGGAGGGACCTAGGGGGAGATACTTTTCAGATACGTCGCGTTTACGCTCGGGTTTTAGCGATTGGGTCGTCCGACGCGGTCCAGAC
CTGCTGGTAGATACTGCGCGGCGTCAGCACGATGGCGTGGACCACCTAAGGTATACATTATGTGGTACACATTGTTTGTAGGATGTGGTCCACATTGACT
TTCAAAGTGAGGACACATCGGCCCGCTCGACGCCGAAGTCGGATCGACGAGCGAGCTGCGACCGCGCGATGGAGCGATGAAGCGAGCACCGCCGGCCGAT
GAGTGGCGCTGCGGCATCGGCCGCCTCGCTCCCTCTTGCCACCGAGGCCATTACGCAATGGCGCCAGGGACGACCGCCGCGGCGTCGTAGCGCACCAGGA
CGTCCTTATCGGACGCCGCGAAAGAAGCGATAGAGCTCGTCGGAGCGTCTTGCCTGGGTCGACCGTCGCTGAAGCCGCGATCGAAACCTGTCAGCGGCGG
CTGAACCGGGAAGTTACACACACGCAATCCAGCTGCGACTCCGAAGCCCCATGCGCAGTGCATTGGGACGATGTGTCTGCGCTCGCAAACATTATCCCTT
GCCGGCCACACGGGGTCAAATCGCTCGCTGCAGCGGCGGCCGCGAGGGTGAGACAACAGCGGAAAGCGGATCGCCTCGATAGAGGATCTGATCGGCTGGT
GGCAATGGGGCCTTCATCCTGCGCCCTTCCATTGCTGCTGCTGCGGCAATGGAATTCGACTGCCGGGGTCGGAATATGGCGAACTTCTGGCATCTGTTGC
CGCATTCCGTACAAGAGGTTCAATATGCGTTGTGACAGGAGTGGATCTTCGAACGCTGGCGTCAGTCCGTGTGTCGCATTTGTAAACCCGCCATCAGTGA
ACAGAAACCGCTTCTTTGCCGCTTGTGGCCCACACAAATTGTGGGGGCTCGAAAAAGGCAACATCCGTTGACCCGCGTTGACACTGTCAACTTGACAGTG
AGTGGCGTCGTCGTCGCGCCGACGCCTTCAAGGCTTGAGGCGCATTACATCGTACTCGCCGCTGCTGAGATGAAGGCGAAAGCTTCCTCGCGTCCAGGTG
GGTCCGGAGCGAACTTCTAGCGCAGCCGCGGAGCGCAGTGTGCGGCTCTGGTTTCTGGCCTGCGAGGCGGCTCTCGCCGACAAGAAACACGTGCGTGCAG
CCGCCATCAGCTCGGTGCGCGCGGCAGGCAACCAGACAGCCGCGCCGGCCAAATGGCGAGCCAAGTCGCTCGCAGCAGTCGTTTTCCAGCAGCGCCAGCA
CGTGGCCCAGCGGCTCGCGCACAGTTTCGGCCATTGCCGCCGTGCGCCGCGCCTTTCAATCGTGACAGCCCGTCGAAGCAGCCGGCAGCCCGCAGCAACA
CGAAAAAGAAGTGTCAAGCATGCACCAGCATGTAGGGCAAGAACAGCCCTCCATCAGCGAGACGCCGAGCAAATGGTGCTGCTCGCGTTTGGGTAAGAAA
GTCGTCTGCTGGGTGTGGTTAAACGGCAATTGCACCCGCCCGGCTTTGGCCCAAAGCCTTTGGGCCCCGGGCATTGCTCACGCAGCCATCTCAGCGCGGC
GCACGTGCCTCCGAGGCCGGCCGGGGCAGCAATGAGCTCCTCGCCGACCGAGAGCAGCGTCGGCGGCGACGCGAGACCATGGTCTGCATTGAACTGGAGC
CACTTCCTCCGCCAAGCTGGCCGGCGGCCATCACGAGTGTTGCCCTTGGTCCAGAGATACACTGCATCGGTTCAGGCGTGGCACACGGTGCCGCTTCAAC
GCCCGACACCAGCCGCGCTGGCCTGTCGCTCGCCGAATTACTTACAAAGCGTATGGTTGTGAAATGTCTCTGGGCCCTATGGAGAATCCGCTGGGAAACG
GCCGTCGCCTCGGGCCCCCACATTATCGAACACCCCTCGGCGCGCGCAGGTCAGGAGCGCGAGCCAACTCACCTCCACCCGCTCCGCCTCCGCAGCTCAG
CATCGATGGCGTTCGCCTCCTCCGCAGTCGAGACGCTGCGGCCCATGAAGCCCGTGTCGCCCGCCAGCGCCACGCAGCCCAAGCGACGCCCGGGCGCGGC
GCCCAGCTCCGTCAAGGACCGCACGGTGGTCGTCTTCGACTGGGACGACACGCTGTGCCCCAGCTCGTGGCTGCACGCGCAGGACCTGCTGCCCAAGTTC
CGCGGCCACCAGATCTCCGTCACGCCCGCGCAGCGCGAGGTGCTGGCCCTCATCGGCGCGCACGTCGCGCGCCTCCTGCAGAAGGCCGTGGCCTACGGCC
CCGTCTTCGTGGTCACCGCTGCCGAGTACGGCTGGGTCGAGATGTCGGCCGCGCTCTACTTGCCGGCGGTGCAGAGCATCCTGGCGCTCCCGGACGTGCA
CATTGTGTCTGCGCGCAGCTGGTACGAGCAGACTTACGGCCTTGGAGGCGACTCCGCGACCTGGAAGCAGGAGGTCATGCAGCTCATCGCGCGCAAGTGT
TTCGCGGCCGCCGCATCTCAGGAGACTGTTGTGAACGGTGCCCGCGCGTACTCTAGGGACCCCACGGCCCCGCAGGACGCGTACTTTAACTTCCTCTCGA
TCGGCGACTCGATGGCGGAGCGGGACGCGTGCTACGCCGCGGTGCAGAACGTGTCTCGCACCTTTGCCAAGACGCTCAAGTTCGTGGAGCACCCAAACGC
CGAGGAGGTTCTGCAGCAGGTGGAGCTGACGCACGACTCGTTTGAGCAAATGTGCGGCTGGGATAACAACCTGGACCTGCGGCTCTCGCGGGCGCAGCTG
GCCGAGCTGCGCGGGTCGCCTATTTAAGCAGCCTCCATTCGTACACTATGGATCGACCAATGTTAGGGATCGTCCACTAGGGACGAAAAAGGTTTTAGAC
AAGAGGGAAGCCCCATGTAGAAGGAATACTCGGGCAGTTTTTTTATTGATATAATAATGCACACAGATCTTCATCATCAACGTTGCATTCGCCCGCCACG
CTGCTCAGCGTTGAAACAGTCTTGGCCAAGCGAGTTACATGTAGCTACGCGGGGTAGCCAAAGGAACATGACGGTCTCATCGAAGTGAGCTTGAAGAGTC
GCAAAGGGAGGATCGATCTTTTAGCCATGGCAACAGCAAATACCAACCCGTTGGCCGAGCGTCGACGACTTCGAGTAAGCTTCAGAAATACAACCACTTT
AATCTTCCTGCACCTTGCAGTGGGCTGATGATCTCGTGGTTGCCATGTAGAAACTCGAGAACCAGCGGCTGGAAGAGGCGGCTCGGCAGCGACAAGAGGA
GCTCAGAAGGCAGCAGGAGGCCGAGCGCAAGCGTCTTGAAGACGGTGGGCAAATGCTGAGATCAGTTCATGCACCTCAATACATTAGCTCTGATACGCAC
GCTTGGTTGTAGAGCGCATTGCCGAAGAGCAGCGGCGACTGCAGGAGCGTGAGGAGATCCGACGGAGGAAGGCGGAGGAGGAAGAGCGCATTGCGAACCT
CGAGAACGACGAGAGGCTGGTGATCGCAGGAATTGAAAAGCAGCTGAAGCTTATTGGGGCCTTTTGGACGTCGACGCTGCCATCTCGTGGAGATGACGAA
GCACTGCCGATGTGTGTGGCAGTGCTAACTGTACGAGCCCTGGAGAATCCGATCTTAGGCTTGGACGAGGATGTTATCCTCGTTGGCGACAACACTGCAA
AGATCCACGGGTTTGACCGGAAGACGAAGAAACTTTTGTTCACTTCCTCTTGGGAAAGTGACGTGGATGAAAGTCTTGCACTACGAACACCCTTGGCGAT
GGCTTCGACTCGGTGCGGCAGGCTTCTAGGTGAGTAAAACGAGCTTGTTATACTGTAGTATTTCGTTAGATTTGAGTCTAATTCGGCTAGTGTGTGAGCA
GGGGTGTGCCCGCGTTGCAGTGATCGAGCTCCGCGTTCTCTTTCAACTGTACTGGACCTGCGCTCTCGCCAACCAGGTGACTGGAGGCCAGACTTGCAAC
TTTGACGCATCAACAGCTCGAACTGCTTTCATTGACGGGAACTTGCAGCTCACTCTGCCTCGAGGTCTTGCGGTGGACGACGCGGCTGGCGAGTTTTACG
CTAGCGATGAGGCAACCAACTGCATCAGAGTGTACAAGCTTCCGACGAACTCTATCGCCAAAGGAGTCACGCTCGAGCGAAGTATTGCTGGTTCTCGGGG
AATCGTGATGAAGCGACCGACAGGCTTGGATCTTTCGCATTATCACGTGGTCGTGTGCGATACAGGCAACTCTCGCTTAGCCGTATTCGCCAAGCGTGGA
GCTTTCGTGCTGACAATTGGCCGCAAGGGACTGCACGGTGGCGAGTTCTATGATTTACGAGACGTCAAGCTGGCTAACGTTCGAAAGGTATGTTAGGTTT
GATTGGTTTGGCTTGTCGCTCTACTTATTAGTTGGTGTGTCTTTCACAGCGAGCTATTACTCGTGGAATTCAGCCTGAAGCCGACGCTGGGATCTCGAAT
GAGCAGTTTGAAGCTATCGTGGCAGACTGTGGCAACTATCGAGTACAAATACTCAACGAGCGCGGGGAGTTTTTAAGGCAATTGTCGCTACTCGGAAGTC
TGGATCAAGTTGTATTTCAACATGATCAGTTTGCAAGCCTACGAGCTGAAATCGAGAGAGAATACGCAGCGCTGCACCAGCGTTCACCTGTTTTATCTGG
TAATCGCATGGACGACATTTACAGTCTTGCGACGAAGCTGCATCCGACGTGCAACCTATACGCTCGCCTCACATCGTACCAAATGGAGTGGCGTGATAAG
CGCTCACATTTCCACCACCCATTAGCGCTTGCGTACGCTCCATCTGAGCGAGAGATCGTTGTGGCCGACCGTGAAAATGCCAGTGTGTACACGTACAACT
TCGACGCTGCCGGCTGCACTTGGCTCCAGCTCCCAAGAAATCAGCTTCGAGGAGTTTGCAGCGTGCACAGCTGTCTCCAGCTCAGCTTTACCATTGGCAA
TCCTGAAGAGCAGGCAAAGGATACACCAAAGAAGACGTGGCTGTATGTGAGTGATCCGACGGCACATCGAGTGGCTGTTCTCGATTCAAGCAACCTGAAT
TTGCAGTTTTTCATCGGCGCCACTACGTACGGCGATCAGCCGCTCTGCTCGAATGGATTTAAGCCCGGAGAGCTGAATCACCCGTCATTCCTCGCAACCT
ACAGCGTAGGCGATGACGAAGTATCTGCAATTATTGAAGGTAGCAACTCTTCTCATCCACGCACTATGCTAGTGATCAGCGACAGTGGAAACCATTCTCT
ATCGCTTTTCGATGCCCGAAATGGTTCGTTCTGCGGTCGGATCGGCGAGGGCTTTGGTCATGTCGAGGGATTCTTCGACTCGCCTCAAGGCATAGCGGTT
TGGAACAACCGACTACTCTTTGTATCCGACCAATGCAATCATCGCGTACAAGTATTCGACTTGCAAACTCGTCGTTTCACGCGAGCTTTCGGTCGTCTGG
GCACGGCACCTGGAGAATTCAACTTTCCTACGGGCCTTGCACTCTGTTCAGCACTTCCTGAAACTCCGAAATGCAATTTTGGTCCTCATCGTTCCGACAA
ACTCGTCGTTGCCGACACTGGTAATTGTCGGGTACAAGTCCTTGACCTAAACGGCGGCGCACAACTCGTTTTGGATGCGAAAGCCACGCCATTTGACCAT
CCACTTTCTCCCGTTGGAGTGTCGGTGCAACAGCGCAGCGGATACATACTGGTGAGCGATGTTGCGAACCGCTGCGTGGTTATTTTCACGAACTATGGCG
AATTTCTCTCAGCTTTTGGAGCTACAGGCGAGGTGGAGACCCGCTTTGTCCAGCCCGCTGCTGTAGTTATTGTCCCGCTGAGTACTGGTACCGAGTTATT
GCTAGCTGCTGACGCTAGTCGCTGTGATATTAGTTCATTCAAACTCCGGTTGTAAGGCTTGCAGCTCACGAAGACATACACCAAATCTATTTTCCTTGGT
CACTTACAAATGACTCGCTGCGAATCGCTACTCTTGCAGGTTGATTTCGCTCAGCTCTACCTCTTCCTCTTCGTCTCCACTGTTGTCATCATTTGAATTC
AATCGCTTGATGCGGGCCGTGGAAGTCGTAGTGGAAACGGGCGCAGTAGGTGTAGTGGATGTAACAGCAGCATCTTCAAGAGGGGTGTACTGGTTCCTCC
ACCGCTTAATCAGCGAGACAACCACCACAATTCCGATGGCGACATTCGCCACCACAGCCGCAACCAGCAGCACCATCGTGAACGTGCTCATTTCGCTGAC
GACGGCAGTCGGGGTTACCACATTGGCGCTCACGTTGCCCGCCGCGGAATTACCTGAGTCACCCAGGTGAGAGACGTTGAAGTGGTCCTCCAGGTTCGCG
ATGAACTCGGCGAGCACTGGGAAGTTGGGCGTGCCAACCCCCGAGACCGCATCCCATCCGCCGGAAGCAGTGAACGAGTCTTGGCACGGGGTATTGCCAC
CACGAGGGGCTCCGTTGTTACCAACGACAACATCGTGGAAAGCGTCGACATGGTTTTCGGCGAGGTAGTAGAGCAAAGGGTTAATGAAACCCAGCGGGCT
CTTGCCAGCATTCAATCGCGCATCGTTCCATAGTGTTACCATGGCGCCGAATACCGGTGTAGATGCTGATGTACCCGATACAGACGAGAGTCGGCCGTTC
ATGATGACGAGATAACCTGCACCTAGCGCGGCGACGTCGGGGTACGCACGGCCACTAGAGTTGAAAAAGCCTGGAGTTGTTGGGATGTTCCTTGTGGTCA
AGTACCTCTCAACGACCTTGCGTTGGTACTCTGGCATCGGGTAGATGTTGGAGAATCCACCGCCAGAAGTAATAATTCCGCCGTTCTCGACGCTGCAGAT
GACTTCCTCCTTCGTCCGGAAGAACGGCTTAGCAGATTGCTGAACGTCTGCCAGTAGCATTGTGGCGCCAACAGTAGTGATGTACGGGCTTGAAGTCGGC
CACTGAGGGCCGCTCTGTTTGCATATTTCGGCGGCTGGGATCTTCTCAAACTCGGGGCGCAGTCCAGTTACGCCGTCATCACCACCAGCGATAAGCACCG
TAATTCCACGAAGACCCATCTTGATAAGAAGTGTGTCGAGTGTTCGTGCGTAGCCCGGCGAGACGTCGAAAATGTGCTCTTCGTCGTCTGAATAACTAAT
GGAGACAACATACGGGGGATTCTCCAGCTCGAGTACATCTTGGGCGAACTCGACGAACGGTTCATCCTCTGATGAGTACGGGTTACTGCCGTTCATTGTC
CAAATGTACGTTGTGGCATTGCGACCCACGCCTGTGATGTACTGCAGGTCCAACGAAGCCTCCGCGCTCGCCCGTTCGGGTCTATTAACGCGATCTCCTT
TCTCGATAATCTTTGGTGGGCTTTCACCAGGCAAGTACTGCTCGTAGAATGTCTGCAAGTCGTCCAGATTGTAGGCCTCGTCGTAGAACGATGGTACACA
CTGCGCATTAGTGGGGTTGGTCGCCACAAGGTCATCCGGGATGCCATACGTCTGTCGAATGGAGGCCAAAGTATCCGCCACAATGCCATTCGCCTCAGTT
GTCGCGGAGGAGGTAGCAACTTGCGCTCGCAGACCGAGTGGGTGGGTGTTGACACTCAAAAACGACACAAAATCTTGCAGGTGTTCTGGAACAGACACTG
CATCCGCCGCACGCATCAGCCTCCGTCGCTTGGGCATCACTTCGTCCTTCGCCTCGTAGTGGTGGATCTCCGTCCTCAGCAGTCGCTCGATGTGCTTCAC
CTTCATAGGCACCTTGTACAAGTTCGAAGTCGTTGAGAACGTCCCCTCGCTGTTGTCATGCGCGTAATCGCCGACCCAATTGCGCACGGCATTGAGCGCA
CCATGAGCAGGCTTGGAGAGCTTGTCCGCCTGCTCCGGGGCGAGGTACTGGCCGTACGACGTGTGTCTAGAGTCAGCAACACAAAAGCCATACCGTCACT
CACTCTTGTGCCTTCTATCAGTGAACACACGTACTGTAGATCGATTAGAGCTTGTGCAAAACGTACGTGGGGTCTGAGACGCTGTAGAACTCGCGTTCTA
GCACATTGAAGTCCTCGGGCTGCAGTCCTATGACCAGAGGCACCACCAGCTCGGGGTCGGCGCGGCTCTGGCGGACGTAGCGGTCGCTGGAGAAGCCGCC
AAAGCGCGCGGACGGGTCGTACACGGCGGCGGCAGTGGCGGACGAGAGGGAGCAGAGCGCCACCGCCAGCGAGAGCAGCCACGGGCCGGCCATGTCGTCT
ACGGCAGGCGAGCTTTAGAGTGCCTCAGATTGCCAGACGCGTGCCACGACGACGTGGTAGAGGTGCACGATTTGTGGATGCATACTTTGATCAAGTGAAA
TTTAAGGTTTAGAACGGAGTGATTAACGGAAAGATGACTTGAATAAAGTATGGAGTAAGATTTAGGATCTGGAACGACGTTGAAGTGAAAGCGCTCAGCT
GGTCGACTTCATGGTCATTTCTATCGATCGCCGCACCCACCGCAGTGCTCTAGGCGACAACATGTATTGACGGCTTCTCTAACTACGCGTTACGCAGTAG
GTCGTACGTGGCGCGGCGATTTCCACCCATAGCTGTCTACAGATAGCAGCTGTGCTAAGTCTCCGCCCCTGGTAATCACTGTCCTCTACTTGTACTCGAC
ACTATGACACTCGCAAGATCCAATCAACCAAGCAGAGAGGTTTCCAATGCTTAAATCCGACACTGCAGTTCACACCCAAAGATTCATGCAGAGACATCGG
CATGGACAGCATCGACAATGCTCCTCAGCCGTCGACTAGCAAACTCGTTGAAGCTGTCACGCTGGACGGTGATTGGTCAGATCTAGAGCCTGGAACTCCA
CTCGCCACCTTCGCCCGATGATGCTCAAGTGCGTCCCGTTCGCCCCGCCCGCGTGGGCCTCTGCGCTGCGCCGCCCACCGGCTCAGAAGCTCCGCCTGGG
CCACTTCCCCACGCCCATCCTGCCGTTCACGCCGCCCGGCCTGCCCGAGGGCGTGCGTTTGTTCATCAAGCGCGACGACTTCAGCGGCATGGAGACATCC
GGCAACAAGATCCGCAAGCTCGAGTTCCTGCTGGCCGAGGCGCTGGAGCAGAAGGCCGAC