Description :
From Genome Similarity Track
Location :
Scaffold_19:34180- 35546
Transcript NameFunction/comments
Physo_132052ABC transporter G family protein
Physo_132053OSJNBa0074L08.3

Sequence
1366 bases(100 bases per row)
CTTCCTCCCCCATTTTGTTCAGTCAGGTAGGTTAGTTTCAAGTCCACGGTAAGTCGGGGTCTGCCTGCCTCTCGCGATGCTAGATAAATAGTGGTAATTA
AGATTAGATGAAGTTGTGGATAAGAAGAGTAGCTAGCACCCACGTTGAGTCCTTGTGTCCGATAATAGTTGATTCCCTCGTTCGATTCTGTTCACCCCAC
AGTGCCGTTGCCGCTGCCGTTGCCGTTGGCTTTCCTGAATTATAGAGTCACCTCAAATATTCACAATGCAGCGTAGCGATGTACCACGTGACGAACACGT
GCAGGCAACACCTCTAAAGTGTCTGAAGTAAAAATGTAAAACGTCTTGCATTCTGTCTTATAAGTTTATGGTGTGTGGATAAGCATACAAAGCTCGCTAC
GATCTAGCTGCTGCATTTACCTACGGCCGGTGTGGAACTTGTAGAGGATGAAGGTGAAGATGAGCTCGAGTCCGATGGCATAGCAAGCCAGGATGATCAT
GTTCTGCGGCGTGTCGACGTCCTCCATGTCCAGCCGCTGCAGGATGGCCTTGGCCGTGGGGGTGTCCACCTGGTTGAAGTGCTCGAACACGAACGACTTG
AACGAGTACGAGTGGAAAGCCAGGTAGTAGGCCCAGATCCAGTAGTCCGGGATCGTCGACTTGGGCACCATAAAGCCCTCGCACAGCATGAACATGCCGT
AGATGCCAGCGCCCAGAGCGATGCCGATGATGTAGTGCGGCACGGCGGCACCAATGACGTGCATCAACGACTCAGCCACCACCAGCGCCAGGAACAGGTT
GAGCAGGAAGTACCAGAAGCCGTGGAGACCCGAGAGCAGCACGACCAGGAACGTCGAGACCGCTGCGATCAGGAAGATACCCGGTAGAGTGGCGATGAAG
TTGGCGACCACGTAGCTGAACACGTTGAGGCCGCTGTTGGCGCGTTCCCGCATGAATACCGCGCGCTGCTCGATGAAGAAAGGTAGAACAGCCACCGACA
TGAAGACCAGGAACGCCTGCACGTAGAATAGCAGCGGGATCATGTCCTCCTCGGAGATGTCGTCGTTGGTGGAGAGGTACATGGTGCCCACCATGAAGGA
CAGCATCGTGTACATGGCGAGTCTCACCCAGTAGATACCCGGGTTGCGGACGTTGTTTAGCGAGTTGCGCTGCATGAGCACGACGAACTGGCGGAGGGCT
GAGGGTTTCACGGGGATAACCGGCGCTGCGTTGTGAACACCGGCAGCGTCCTCGTCGATCTTCTGCACGATACTTTGAGCGATTGAGCTGCTGCTGAAGC
TGTTGACGAGTTTCTTGATGTCCGCGTGGCCCTCGAAGTCCGAGTTGACCAGACTGATGAAGTACT