Description :
From Genome Similarity Track
Location :
Scaffold_22:34171- 36462
Transcript NameFunction/comments
Phyin_T30-4PITG_11532Putative uncharacterized protein

Sequence
2291 bases(100 bases per row)
CGTCCAAGTCATCGGCGAACGAATACGTTCGAGAGGACTGAGAGCTCCACCCGCAGTTCTTGCGTACTTTCCAGGACAATTTCTTGGCTAGAGCACACGA
ATTCTTCCGTGCGTATGCCGACCACTGCGTCGCGATAGTCTGGAGTGACATGTTCTTGAGCACCTCATTTTTCGTGTTGAAGTCGAAGAAGCCACGAACG
TAGCACTCCACTGTCGTGGGTGTCTTTTGGCGGTACAGTGCGCACACGGACATGTTTCCTCGCTCGATGCCGTGAGATCGCTCAAAGCTCGGGATGTCCG
ACAGAGCCACCGAGTGTGAAATGCTATATCCTACTCGTTCGCATCCACCGACTTGAGTGATTCCTGTTGCATCGAGAGACACGTAGTCACGTCCCTCGTA
CAGTCGCCATTTTACGGCGACGGTACGGAACGGGTCGTGAAAGCTTGGCTGGACGATCTCGTACAGCACCTTGCTGTCTCGAACGTTGTCCTTCGTGCAG
GCAGACTGAATCCTCATGGCCTCGTCCGTGGTTGCCACTGCTCCATACATGACCTCTTCTAACTTCCCCTCGATAGTACCTAGTAGTAGAAGCTGCGGTG
TTGCTGGACACTGTGCAGTAGACGTTAGGCGCTCATTGTAGATGCGCACATTGCCTCGCCGTCGAACTTCACGCCAGCGTTGGGGATCGGCACGACCGTC
TTTCGTCACCACGAGAGTATTATACTGGGAGATGTTATGTCCTGCGAGTGTGTCTGCAAGGTGCTGCAGCATGTTACAGTCCTGCCTAGATATGGTAGGC
TCTGGTAGCAAGTGCACGAGCCTCATGTTTGCCGTTGCTTTCTAAAATGGCAATGCGCCGTGACGACTAAACTCTACGCGAGTTCGATGGTCTTCTTCAG
TGTGCGTGCGAAGCAAACGGCGCATTTTTGAGAACAAATTATAGCTCAAAGGCCAGTGGGTGCCTTAGAAGAGTCAGCAGACAAGAATAATAAGCTGTGA
GTCGTCGGACCTCCGGACTTTACCACGGCGATACAGGAACGGAGCTTCAGGAACATGCTGCTGACCAGCGCCAAGCTACTTAGGCCAGTGCTGGCGGGCA
CAATTAATTATAATAAGCATGGTATCGAACGATCGTCATGGTGCCCCACCGAACCTCGGTAACGCCTCAGCTGACCTTGCGGTGCGTCTGGACTCAACAT
GCACCCCGTAGGCAAGTACAATAGTAGCGGGACAAGCAGTCAGACTTTGTTGCCTTTTCGAAAGTACTCACAGTTACTGGTGCTCGCTTCTGAGCACTTG
TCAGGTTGGATCCGGAGTCAGGTGCTCCTGTTGCCCGCGGTGCTGGCCACGACATGCCCTGGATTTTGACTTAATGCATTCAGAGAGCTCAGACTGAGGT
CTATCTTGGATATTACGCAATGAATCGCCAAAGCCACCGCACCGTACAGTCAAAAGCTTGCGGAAACCTTGGAGGTTCGACACCCGACTGCTCCAACATA
CGTGTGCGTGATGCAACTTCCCACAAAAGAAAAAAAGAGTGCCAACTTCATCTGCGCATGCAAACGAAATGCTTAAAGCGCAGCGTCCGCTTTCCAACCC
AATCCGTTGATGCATTAGCTTGCGTGCGCAAGAATATAAGTAGTCGGCACGTAAATGAATTAGACTGGTCGAGTGCTGTTGTGCGCCTCATCTATAAAGT
ATCACAAGATTACTTTCTCCTCCAAACAGCTATGCAGCTGACACCCACTTAAGAGTCACTCATTCGAATTTAGGTGCTGCTGTTCATGAAGACCAACCTC
ACCAAATGTGGCGTTGTTCATGCTCCATGGCTTGACGCTTCCAATCCATCTATTGATACAAGCCCTCAGAGAACGTCCGATGTGCACGTCGCACAACAGC
AAGCAGGGTTGGCAGAATCTGCAGTGCCCAGACATCAATTACTGCTCTGCGCTGGTTTCGTGCACACGAGTGCTTCCTGTCATTTGGTCGGAACAGGTGC
ACAAGTTTGGCGCCAAATCAATTTGGCTGTACTGAATTGGCGCTGAATGGGTCTAAAATGAGCGATGCACTAGGCGCGGAGTAGATCTTAGTGGCTTGCC
ACGATGGATACGTCTTTACAATTTTTAAGATGTTGACATATCACACGCATAAAGTGATTTCTCCGACTCCATGAGGCATGCGCATGGTAAATATGGCAGT
TAGCAAGCTGAAAAATGGCAGGTTATTTCTAGGGCTCACTCACATAGTTTCGACCAATAACAGTACGAGAATCGTATGGGTGTCGGCGTGG