Description :
From Genome Similarity Track
Location :
Scaffold_670:3417- 7463
Sequence
4046 bases(100 bases per row)
TATCCCGCGATTTTTGGATTCCGGGGTATCGCAATCGGGTTCCGCGATCGGCAGTAGATGTGTCCCCTTGGTCCGCCCGAAGGAATGAGCCTGATCAGCG
TATCGGAGCTAGACATAGATTTGTTCTATCATCACTTTTCAAAGCCCAATGGATACATCTTCCCGGTCCAACTGGGCAAACTTCGCCCTCCTCCGGAGTC
GTCCTGGTCATCCCAGCTTTGATCATGTCGACTAAGATTGAACAATTTTACGATCAACAACCTTGGAACCATTATGATCAAACCATACACCCGATCTCGT
TAAGCCTTCTGGCTGGTTCGAAAAACTGGTCGAGGCGTATGAAGTTATCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACTCATTTCTTGTGGATC
TCCGCTGAGCACCGTAAAACGGATCCTGGATTGGTCGCTATTGCGCGAGCGAGAAGGCAGAGAAGATCTCGTGCTGGTCCCTGTTGGAAGCGGGTACTGC
AGCTGATTCTTCAAGGCATGATCGACGGCCTCTGCGATTTGGACATTTTACTGGACTTCATCTTTCTACACTTTCCCCGTCAGAATGAGGCTAGGGCGTG
GTATCCCGGCCTATCCGTGCGGCGGACCAACATACCCAACTAGATCACTGCTTTGTCGATCGATCACGCTACCGAGCGTTGGAGGAACCAGTTTCTTCCT
TCGATAGCATCCCACCCTGGGTCGTCTCTTCCACGCTTGGTGGGTAAGTTCTTTGACCGCGAGTAATTTACTTGGTCTGTTCCATGACGCGATCTCTCAA
TATACTTTCTTCTCATTTCCATTCGATCGCTCCCATGAATCGTATTTCTTCCATCTTTTTTTTCTTTTCATCTTGATCGCACCATTAAGTCTGCGATCGT
CGCACTCACTTCACATAAATCTCATTCCACCTCTATGTGCAACCTCCTTGCACCCATAACTCTCCTTCCTGTCCATGCACCGTCCCTGCATAGACCCATT
CACTCAAGCTCTCCTATCATCGCCAATCTCTAGCTTCTTCTTCGTGCGATTACATCACCTCAAAACGATCCTTGCTCACCTGATCACGATCGAACTCCTG
CAACATGACTCCACAATTTAGATCAGCTTCATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTGTACCAGGTACTGCTTGTGTATTCGGCCATATTCG
TCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCGAACTCGTCCGCGTCGATATTACCCTCCCAACTGACTTCCGGCAGCAGTGTTTCATCAAA
AATCAAACCGACTGGCCTTATCCACACTCAACCCACCCGTTGGGCGTTCTGGGAATACGCGAACTAGCTTCAGCTTAGACACGTGGACTATTAGGAATAG
CCGGTACGGCGTGCCCGCGATATCCAGCTTTACGGCGTGATCGCCACACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTCGAGCA
TATCCTTTCTTGACTCGGTTCAGATATAGCCAAACTTGCGACCCGCGATCGATATCCAATAAATCTGGATTTTTTTACGTCGATCGGCCCGAACTCTGAT
CGCAGCCTCCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGTATACAATATCTCCATCTTCGGGCATCTTGATCCCGGGGTTTGGTA
CTTCTCAACGGTAAGGTTGCTTCTAAGGTCGATCTTGGGTCCCAACCGTGAATCAGGTAGAACGGTGTATCTCCTCGAATTCGATCATGAGCGGTGTTGA
TCGCATAAGTCAATCGCTCTGCGTATCAGTCCCAGTCCTTTTAATTTTCATCCATGACATACATCTTGATCGATCGGGTCAGCGTCTGCACCATGCGTTC
GGCCGTACCATTAGCTTGCGGTCTATACGCAAGAGTGGCCCGTTGTTTTTGTTCCGCGATCCAATGGAATGCTTGGAAGAAATCAGACATAAATCCCGGC
TCGCGATCATGGCGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCACTCCTCATAATTCTCTGCGATCCTCTGGGCAGATCTGGATGAGCTTGCTT
TTGCGATCACATATCCAGAGAACAAATCGACCCACAGCAATTGCTCGGTGTTTCCTCAAAAGGATCTTGGCAACAAAGGGATATGATCCATAGCTATAAT
CTGAAAGAGTACGTTGATTGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCTCATTTCACAATCTACACACTCTCCCACATACCGCT
GCACACTTCTGTACAACCCACGCCAATGTAAATTCGCTCTGATCCGTTGATAGGTACGGCCGATTTCTCGGTGAACACCCTCCAAACTTGTGTGGTAGTG
GTGCAAGAAGTCTATCTGTAACTGTTCTGGAAGTATCAAACGAGCCAGTTCAGTGCGATCTTCAGCTTCGGTAGCCGATATCGGACAGAAAAATAGCAGC
CCACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGGTGCGCACCTTAGCTTCAGCCACCGATAACTTAGCTACGTCTCCAAGCAGATATACCTTCAAAT
TAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCCGCTGCACAACATCTTCCTGTAAAATTCTGGGCTGACATCGTCTTCT
CTAACGTGTTCGAGTGATAGCCGCTACTTTGACTGCACGATCAACTCGTTCAGGTAGTAGTAAATCGTTTAACCTATTGAGAGTAATCAGGTCCTGACGC
TCTTGATCGAAAACCACACCTTTTCCATTCTCTTTCCGTAGAGCTTCACTCGCCAATCAATCTGCACGCTGATTCCAGTCCCGCTTCATGTGCAAGAACT
CGTGGGACGGCCACGATCTTAATCTCTCCATAGCCCTATGCCTCAACAACTGCAGTCCCGGTGCTTTACAGTCGATTTCTTCTCGCATTTGACGGATCAC
CAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCGGATCGGCAAGCAATCGAAACTAAGGAGCAGCTCTCGGTATTCTGCTTCATTCACGGTTA
GATCAGGGGTATACTCGGAAGCGGCAGGCACAATTGTCCATTCCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCCCTTTCTTTTCACACTGGCTGA
TCCATCGAAACTGGCTACCAGCAGTTTTCATTCACACCTACTGTGGGTGGTGGCATTCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAATCA
ATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAGATCGCCTAATTTCCAACGTCCAGCC
CATCTTCCCAATCTTCTGTTGAGGCCTGAACATTGTAGTAACCATGCTAGTGTCGAATATCGCGTAAGCACCGTAATCTCACGGGATTCTAGCATAGTAT
AGCAGATATCTAGCATCCGGAGGAGAGCCAACACTTCTTGCTCCACCATCCCGTAGTTGCCCTCGTTGGGCTTTAGCGTACGACTGGAGAAAGTGACAAG
CCAATACACACCATCATATTCTTGAAGCAAAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATCACAGGCGATCGATCGGGATCGAAATGCTTT
AAGATTGAAGTTGTGGCTATCTTAGCCTTTAGCAACGTCAACGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCGGGATCGCGATCGTCCCCTGCAA
TTGGGTACCGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGATCGACCCCTGCACTCCCTTCGTGAATAGCATCAGGTCTTAAAGCAGAGGTATG
TTTTGGAGCTTCACTCACGCGGTTGATCCCATGGAAATCTGCTTCACGCAGTTCGTACAACACTGATGCGTAAACTGCAAAGTCTTCAATGAATCTACTG
TAATAGTTGAGCCTTCACAAGAAATAACTGCATCTCTCACAGCGCC