Description :
From Genome Similarity Track
Location :
Scaffold_243:3417- 4692
Transcript NameFunction/comments
Physo_144684reverse transcriptase

Sequence
1275 bases(100 bases per row)
TTGTCCAAGTCTTCGAGCAAGTCGTTGACGAGCGGCATGGGGTAAATCATCAACTGTGTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATAT
CGACGGCGTTCTTCTTTATGATCACGACAATGGGCGATGCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCAACAGCCCTTTGATCAAGTCAGC
GACCTTCTCTCGAAACTGCGGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCAATGTCGCAGACAACACCCAGGGCGGCTGGC
GGCAAGGCGTTGCCGATCAACCACTTCCGTCGCTTCCAGATGATTTGGAGTAGCCGCGTTTCTTGTCTCGCGGCTTCCTCGGGCGGGAGTCCAGTCGGCA
TGCCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGTGAGAGGTCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACAAAGAGGTCGGACCC
CTCGTGGATGAGGACCGCGTCGTCTTCCTCCTGCTCATCAGGTTTCGCCTCGTCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAGTTTGGCTCGTCGA
GTATTTTCCAGTCACAGTCGGAGGCATATCGGGTTCGCTTTCCACCGCCTCCTCGCCGTATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTC
CCTTCGGCGCTTCCGCGACAGCCACCAACACTGGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGATCCGGGCGCAAGATGGCTTTAGGCGTCGGGTA
TGAGGGGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATCCAGTTCACCTCCGCGTCGCGCGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTAC
CGGGTGGAGCCCAGTCGGACGAATCCACGGTTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTCATGTGCGTCGAGGGTTATCGCTGCGT
CTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACGGCGC
GTTTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCGGGTGCATCCGTGCGCCGTATAGCGGT
CTTCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCATCTGCAGTGTCGATGCGCACTCCA