Description :
From Genome Similarity Track
Location :
scaffold_306:34159- 35283
Sequence
1124 bases(100 bases per row)
TGGACCTCATCGATTTGGAAAGACAACCGTAGTACTCCGACTTCGGGAATTGCTCGGGGCACACCCGTCAGTCCTCGTTGTCTATCTCTCGCTCAACCCC
GTAGTTGTCGAAACGGAGGAGGACTTTTGGCTTGCGCTCTGCAGGACCATTAGGGAAGAAATGGCGTCATTTGGAGAGTTTCAAGATATGGTTCGGCGTC
GTGGGAAACGTTTGTGGCTGGCTATTGATGAAATGGATACCATGCTTGGGAATGAAGAACTTACCAGCGATTTCATGGGGTGGCAAATCAACCAATATTT
TTTGGGATTTCTTGGAATTGGGAGTGATGCTTTGCTAAGTATGCACATGAAGCTCAAAGAAACCAGCTCCAGTCCTTTTGAACTCTTTCAGATCCAGCCT
TTTACCACAGATCAAACGGTTAATTTCTTCAAGCAGATCGAGGGATGCTATCGCTTTCGAGATTCTACCCGGCAGGCTATCATGGAGTATTCAGACGGTG
CTCCAGGCGTATTAGGAACTTTAATACGGTTCTCGATTGATCATGGAAAATACGACCAAGAGTGGCCTGAATGGGAGAATTGGTTCAAGATCCAAAACTT
CTCCGAGTATCTCATCCGTTGCGTTTATGCGAAGTAACACACTGCTTCTTTGAGATCAGTAGGCCCGACGGTGGTGACAGAGTGCTGTATTGGTGATTCA
CCAATACAAAAAGTCAACCAATGGTGAATATTCCGAAATCTATTATCATGGATGCGAATTTACCGATTTGTTATCCAACATACTACAGAGTAGAGATAAT
TGCCCTGGTTCGCATCGGTCCTGTCAAAAGTGTCAACACGATACCCGAGCACGTTCTTCCTTTCGGGTCATCAAACGAGATTAAAGGATCACGAAACCAC
GAATAAAGTGCTTCTTCGTGAACCTCCAGATTAACGGAATGCTATCTCCAGCGTTCCATTGTTACTACGAGCGCTTCTCCAGATATTTGGTCGGAAATGT
CGAAAGGGGGTGGCTTTTGAATCGTCAAGTTTGGGATTCTGGTTAGTGAGAGAGAAAAAAAATCTTCCAAGGGTGGTCTCAAGGTATCTGTACCAAATTC
TCGGACCGAATTCCTGTCTTACGA