Description :
From Genome Similarity Track
Location :
Scaffold_1:341555- 346910
Transcript NameFunction/comments
Hyaar_Emoy2800095M96 mating-specific protein family

Sequence
5355 bases(100 bases per row)
CTACCGGACGACTCCGTTCCACTCGATCTGTGGATCCATCGACATCACGACACTGCACATGCACTCGCAGGATAGCGTGGGTTTGCTGGAGCCATCGGAC
TTAAGCAGGTACTTCTCCAGTGAACCGCAACGACCAAGGAAGTATCTTCAGTCGAGGTGACTCGACAGCTCCCAACTAATTCGCCAACTGTTAATCCTTC
GTCATGTTCGCGAATGGCAATCGTCTCAGCATGACGTCATGATACCTCGCCGTCTCAGTTGCTTGTCCACGAGGGCGTTCTCAATACAGTCCTGATGAGC
TTGCATCTTTTGAGCTGCAGTCACAATGAGAAAGTTAGTGACAGCACGCACGGTGTCGACGCCGTGAAGGGCCTCAGCCTCTGGTTCTAGTGAGATCAGT
GAGACACACTGCAACTGCGAAATCTCGTGTTCCGGTGTCGATACTGGAGAACGCTTCGTCATGGCGTAGCCACGAAGATGATAAGTAAGTCCACGCAGCA
TCTTGTGCTTAATCTTGGCAGGTTTTGCCACCGACACCCAGATGATAATATCTCGGCCGGGTTCCATGTAGCGGCGAACAAGTTGTTGCGCCTTTATATC
TGCTCGAGCGTTCTTGGAGTGCATCTCCTTGGTAAACTCCTCCATAATTGTGTACGGATCTTCGTGACTCTAGTTGTAGGCAACCGCAACCACAACACAA
ACTTATGTTACAAGCAAACCTCAAGACTCCTCAACAAGAAGAGCACTCCAAACCTTTACTGTCTTCTCGTAGATATTGCCATTGCCCAGATGTTTCTCCC
CTCCCTTAAAGTGGTCCCACGTAGCCTCAGCCACAGCACGCAGCTCAAAAGGTAGCACCTTGTTTGAGAACGCTTCGAGGTATTTGCCGTTGACACCGTC
GCGAAGGTGTACGTCGCTGGGAGTAAGCACCATATTCGTCAGACCGTTGGAAGTGAACACGGCATCTACCTCTTGACGTGCCGTCTCAAGATGACGAAAT
AAAAGAGGAAAGTCTCCTGCATCTCCACACTGAGAGCTCAGCATGCGGACAAAACACTCTCTAGTGGCGTCGAATTCCATGAAGGACGAGCAGTCACTCA
TCTACATCCGGATTAAACAATAGCACCACAAAGTTAGTGCTCACGATCCACTCATGGCTCTTCAAGGTTGCAGCCAGCCTGAATAATCACGCACCAAGTG
ACTAGCTCGTTTTTGCACCAAGTTCTGCATCCAATGCGCCGCCTCCTGCTGTTGGTGCACAGCAAGTCTTAAACGAGCATTTTCACGCTCACTTTCTTTC
AGCCGCCTGTGCTGTCGACCTGAAATATCGCCCCACACTCTCGGCATATCTTGCATTGTTTCGATCGCATCCGCAGGTCCAAGACGTTGGAACCGAGCAG
CTTCTTGACGACTCGATCGACTCTGCAGAACCTGCAGTTCCAGCTGAAGCTTCTCGACGATTTGTTGAAGATAAGCAAGTTCCAGTCGACTGTCTTTACC
GTTGGCGTCATGACAGATACCTGTTGTTTGCCACAACCTTTTCCGCTCATGGGTCTCTCTTCTTCGTCGTCTCCGCTTCTTTTCTTGGTGAGTACTTGCT
ACCTCACAAGTTGTAGCTGATCTTGCAGACGTCAACTCGTAGGTGCATGGAGCCATACGCGACGTCTCGAATCCAATAGGGACGCTAGCCACGGGGTTAT
AGCTGCTGGGCGACGGAATCTCTTCGTCTTCACGCTGCATTAAAAGGATCGTCCTCTTTAGCGCCTCTGCGTCTTCCTCTTCATCATCTAGCACGCACTC
GTTAAGAAACGACAGTGTAACTTGGAAAGCTCGATCGTCGTCGTCATTTCCACTTAGAGCAAACACCATCGTCTAGACCCTGACACGCGTGCGTTGATAT
CCACTTTTGACACCAAAAGGTTTGTGATATGCTGCACACCATCCGCTTCTGAAGACAATGGACGTGACTCTTCTATGCACTCTGTCCATTTGTGTAAAGA
CTCGGCTCTCGCACCTTCAAATCATTGGCGACCGCTCCTCGATTGCTGATTACGAAGGAGCTTGTTGATGACAAGTCGTTGTGCAGTTCGAATCGAACGC
TGGATGCTCACGGTAGAAGGACGTGACACGGCCGCTGTATTGGTCATTGGATCGTGCTGGAAGAATGGTTAATTCAACAGCGGAAACGATATCGTAGCTT
TAATCCTACTGATACGACGTCGTTTTCTCCGAGACACAGTCCTGGACACAAGATACAACATTCCTAGCTGTTTCGGCTAAAAAGTCGTTCTCGATGATCC
CAAAGGGTGTAGGGACGCAAGTCAATCAGTATGCAAGAGACGCATACTGCAAAGTCTACTGTTAGAGACGTACGACCTCTAGGCTACAAATCCCGAAATT
AACACCTGGCACTTCTGACGGAGAGGGCCTCTTCCTTGGTGTCGGCTTGCAGTAGCGACAGCGGGTGACGCATGACGACCGATCACCAAGTCTCAACCAG
GTCATCTCTTCGACAAAGTTGCGAGAGTGAAGCAGCTCCATGTGGTTAAATATGATGCCCATCCCCGGTTTATGGCGTGTTAAAGGACAATCGTCATCGT
AAAGCAGTAACGAACGTCTCCAAAAGCCTCCACGGACTCGTAATGTTAGTCGCAAACGCATTATCACTATCCATCTGGGGGTAAGTAAGGGAGCTCACCA
CACGTTACATCTACAAATTGAACGAGGTGGAGATTTATCTCGTCGGGAGCAGTGCGACCATGAAGTCACTTATGCTACGCAAAAAGCTAGTTTTTACGCC
ACTATCATTACTCATGTTCCGATAAGACGTTAGTCTTCGTCGCGGATACATGTCGCTTTATGAGTTTAACGTCACTTATGCATGTTGTCGGCTCAGTACG
GACTTGCTTGCAGCTGAGATCGTTTGCTCGGCTAACGAATCGCAGTACAACCAGTCGTATACTGTGATACTATAACCACTAGCTTGCTTTTAGTGTCGCC
CTCATCAAGCGCTCCCTCCGATATGTAAGGGGTTGATGGAAGGGAATTCTAACAACTTAGCTCTACGAAGTACAGCAAGCGTGGGCAGAAGGATGGATAT
AGCAATTGCTGAAGAGTACCAACTGGAGTTTTCGAGAATTTGACAGTTGTCGCTTCTGTTCTGGAAGGGGAGACCCATCCGCAGCTGAAGTGTTCGTAGC
CACTCGTATAACATACGCCCATATAAAAAGGTGTCCTTGGGTTATGAGCCAAAAAAGTAGATTATTTCACTCGCTGTGTCTTGCACTCTATTAGTATCGA
AGCCATCCTGAAACCCCCTGCCTTTTTTGGCGTGTGTAGAAGCGCAGAATTATTGTTGTTATGTGAGACTTCAGTGCCGGTCGAGTCATGCCATATAAAT
GTTTTAAAAATTCCGTATCTGGTGCTCCGCCATGGCGGGAGCTCAAAGACCGCCGCGTTCAATAACATTGTCGGCAGCATGATCTTAAGAATCATTACAT
TGGCTAAGATTTGTTCTGTTCGGAATGTAGATTTCAGCCGAAAACCACCTACGTTGTAACGGGACACCGTATCAACACACTGGACAACCAGTGTGGAGCT
ACTATCACCGACAGCAGCGTAAGTGGTGCCTCGCTACCTCTGTTAATTTGGCAGAGGGAGGGAAAGCAACCAGGAACTGACTAGTTGCGGGTAAAAGTAA
AACTGTATTAAATATAATTAAGTCCTAATCATTAACCTACGTTTCAGTCCTAACTTGATTACATTTATCTACAAAAATGTATACTAAAGTCTTACTCACC
ACTCATTGCGCGCGTCCATCGTTGATTTGTACCACTAGAGCTGGCTGATATGATGATCCATATCATATCGCTGAGTGTTTCTGAATATTACCCCTTATAA
TAATATTCACGAACATTATCAACCTTTATGATGATATTCTAACTAGCAAGTATCAAGGGTTAATTACATGTAACAGGCTCACCCCGTTACATCACCCCCC
CCTTAAACGATAGTCACTCAATCGCTATCATGTTGATGTGGTCACCGTTAGACCGCATCAGGGACAGGGATCACTTGTTTTGGTCTGATCCATTCATTTC
TGGATTTTCATCGCATAATGAACAACTCCATGCGATGCGCGGCGAAAGCTACTAAGAAGGCAGCTGCGCGTGTTAACGCAGCTGCTCTTGAAGATGCTAG
TCTGCTAGCGGCAGATGCACGTGGTGACTCACCACGTGCTAATGATGATGGCTCCCAAATGGAGCTTATCTACTCGGGGGAGTCGGAAGGTGGGTCTGAC
TCGAAGAAGACACCTAGGTCACCCGAGTCTATAGGGACGGCCGAATACGAGCCTACGAATAGGAATCGAGCGGGTAGTCAGACTCATGGTCACCACCAGA
GTCTGTTTAGTTCGGAGGATGAGCATGCTGACTCATCCCCCGCGCCTGCTACTGCGCATTCGCCTTCTAGCAAATGTGGTGATGACTTGAACCTTCGTAA
TGACGATTCTAGTGGTACTAAGACTTCCATTGGTACCACGCAGGAGGCTCTAGACGGCAATGTGCTGCGTCTAGCCCCTGAACACAAGCCTTGGGTATTA
CCAGAAAAGCTTGTGAATGACCTGTCAGGCGAGACAAGTCTCCATCATCGAATTCCATTATTCGATGCGAGGCTGTTGCACAAGCTCGACATCAGCGCTA
GTAACTTTCGCGCTAAAGAAGAATTCTATCTGGATGCTTTTCTGAAGCATCGTTGGTATAGTGGCAATACTAAGCGAGACAAAAGCTCGTTGCTGCAGGC
GTGGAACGCCTTTATAGTCAATGTGCAGCACATTAGGCGCGAAGCTTGGCTTTGGAAGCTTGACACAGCTCGAGTTAGGTTTAAGAAACGAACCTTAACT
GATGCAAATGCCAGGTTGCACAATCTGTCTCGTTAGGCAGGAATTACATGCCTCACGTGAGGCGACCCGTGTCCGTGTTGTTTCGACAACACTCAACGCA
TCCAAAGGGAGGTGCACTCCCTTTCTTCGCCCTGGGGTAGGGTGCACATCTCTTCTGAGATGCGCGATGTGATTGCTAACCTATTATCGCTCTACCAGCG
CCATGGGCGCGTGTTTTCCAATGGCTCTTCTGAGCCATCGTATGTGTCTCGTCGTACTGGTGGACAAGACCCTCAACGTCAATCATCAGCTGGGCGCCTC
GCGCCCAGCTGTCGTGCGACGGCAGATAGCCGCGCCAGCGAACAAGATAACTCGTTCGTTGCCCCTTCATGTCACGGTGGTTCAAGATACGCTCCACGAA
GCGTTGACCACCGTGCGAGTCCACCCATGGCTGTGGTGGGGGCGGGAATATTAAC