Description :
From Genome Similarity Track
Location :
Scaffold_109:34151- 40250
Transcript NameFunction/comments
Phyag_g2180protein kinase, putative
Phyag_g2181hypothetical protein PHYSODRAFT_553035

Sequence
6099 bases(100 bases per row)
GGTGGACGCACCCCCcgaggcgctggaagacGTTCTAACGCGATGGGAGAAGAATCAGGTCAAGTGGCGTCGGCGCGCGCCCAGCGACGTGGACAATGAC
GACAATCAGGACGGAGCAGAGGACACGGCGGCGATGCTCGAGGACGGCGGAGATCTGTTCGAGAACGTGCAACGGGCCGAGATGTTCGACGTCACTTTTG
GAGAAGGATTTTTAGGCCTGGAGTTTGTGTATGACACCGTGCGGAACAGAGTGGTGATCAAAAGCGTCCACGCAGACACGTGGTCCTCTGTGGTGATGAA
TATCCCGACCGGGGTGACGATTAAACGAGGCTTGGCGGTGGAAGCGGTGAATGGACGGGATGTTGCAGCGATTTCGCCCGAAGATATTCTGGATAATTTG
CAGTTTAGTAAAAGACCCATGACTGTCAAGTTCCGACGAGCAAGAAAGTCGGCCGTGGTGTGTAAACTGTGCGAGACGAAAGTGCACGCCAACCACTTGG
ACAACCACATCAACTTTTGCGTGCTGTCGAAACgagtggagctggaggcggatTGTATTAACAATTCACTGGTGAAACTCACGGCGGAGATTAATGTGAC
GCTGGCGGAACACGGCATGATGGCCATGTTTAACCAGGAAGAGATGCACATCTACCACGCACTGCGCGTTGTGGCCATCCAAGCGTCAACGTGTGACGTG
ACGAGTGTGGATGCCTTCGCCTTGTGTGCACGACTAGTGAAAATTATCGATAGAATACGACAGCAGGAGGTGGATGCGACCAATTTGGACGGGGACAGCG
GGACCAAATACTGCGTGAAGCTACGAAACTTGATTCATGCCAAGATGAGCAAAATGCGAGCGTCTCACAAggtgatgttgaagcagGCTCCGGTTGAAGT
GGTACGGCCAGCGTTGAAACGCACAaagtcgctggagaacaTAGAGATCACCGAAAAAAATCGAGCGCCGCGCCGTCACAGTGTGAAACCAGCTACTTAT
CGTGTCTCGATTCGTGATTTTCAAATTGTCAAGCCGATCTCGAAAGGTGCGTTCGGCAAGGTGTACCTTTCTCGAAAGAAGACGACTGGGGACCAGTATG
CAATCAAGGTGCTTGCGAAAGAGCACTTGCTTCGCAAAAAACAGGTACAACGCATTGTGAGATAGTCCAGCCATAATCATAGTGCTGACTATTATATTTT
CCACCACAGATCCAGCAAATTGAGACAGAGAGAAATATTCTGGCCAGCGTGGTGAGCCCGTTTGTTGTGAAGTTGTTCTGGACGTTCCAATCCAAGTAAG
GAATTCATATTGCCGATGCAGTAGAAAACCCACGCCCGAACTACCAGTGACTTATACTTGAGGATATTTATTTGCCAGGCGCAATCTCTTTTTGGTGATG
GAGTACCTTCCTGGTGGTGATTTCATGTCGTTGTTGGAGTGTATCgtgcagctggaagagcatGTAAGCTTACAGCATTTATTAGGCAAAATGACCAAAC
ACGTCGATGATACTGACAACTGAACGCTCTCTTCGAGTTTAGGTGGCATGCATCTACATTGCGGAGATTGCAATCGCGCTCAATCACTTGCACACGAAGG
GCTGTGTTCACAGGTTCGAAGTGCGCTTTGATAATTTTAGAGAAAAGCATGCGTACTCATCAATTATTCACTCGTCTGATGGTATCCTACACAGAGATCT
GAAGCCCGACAACATTTTGCTTTCATCAACCGGTCATATCAAGGTGCGCGTAGCTGATTTCAATTTCCCCACTGACTTAACCTCAACTCTAATCGTCGCA
AACTATGTTTTTCCATCCAATAGCTGACTGACTTTGGCCTATCCGAGGATGCTGTGGCTATCAGCGATACCGACTCGGAGCCCGACGATGAGTCTATGGC
TCAAGACTCGGAGATATTGCCTGGGACCCCTTTGGGCGATGCGACAGCTGCTTTGGCAGCAACCCGCCCGCGGCGCACGTCatccaagaagtccaagaaa
aAGAAGTCGGCGTATCACACCTATGGACGATGTGGGACTCCAGATTACTTGTCGCCTGAGATCATTCGGGGAGTCCCACATGGCCCACCTGTGGATTACT
GGGCCCTAGGAATCATCCTCTACGAAATGCTGGTTGGGTTTCCCCCGTTCAACGATGACACCGTTGATGCGATCTTCGGGAACATTCTGGAGAGGCAAAT
CCTATGGCCTGACGGCGAAAAGTGTTTGTCACTCGAGGCAGTGGATCTGATAGACAAGCTGCTTGACCCAAATCAGGACACCCGTATGGGTTGGGATGGG
ATCAAGCTGCACCCGTTTTTTGAAGGTATCAATTGGGATACGATTTTGGAGTCTATTCCTCCGTTCgtgccgacgctggaggGACCGACCGACACCAGCT
ATTTCAACAACCGTAATCTGACAGATGTattcatcgacgacgacgagttcgatgCCGCTTCTCAGTCCGCAAGTAGCAGCCAGAACAACATCGACTCGGG
CACTGAGAGCGACGATCGGCCACTGAGTTCATCGGATCCgaaaggagaagaggaaTCTGACATCGGCAACAACAATGCAAATAATTTCTCTGCAGGCACG
ACGGATGTCGACATGTCGTGGGGAactgcaggagcaggagcatTAGGTGCTCTTGATGCGATGAGCAGTTCTGTAAAAGATGAGAGTATGGGCGAGGTTT
CCATGGACGACAACTACAACCACTATCGGTTCCCTAGTGGAATGTACGGCAGCCCAGATGATTCTACCATCGCCGATGCCTTCAGGTCGTTCAGTTTCAC
AAACATGAATGCGCTTGCAGCTGCATCGCAGGCAGAAGCCGAAATGATAGCTGGCTCGGCGCAGCAAGTCGAGGAAATTGCGTCCGGTCCGTCCATCCTG
ATCTAGCAGGGTTACACACATCGACGATGCTTCCAGTTCCTCATTCTTTTCTACCACCCTCCTTGTGCCCGTGCCCCaagatcttctccatctATATACA
GTACTATGAGCTCGTCAGCGTAAAGACTATTAGTAATAAAATCGCAAGAATTCCGTGACTTTGAAAGTACAAAGCACATTGAAAGTGCGTTCCGTAACCA
TGTCTGCATTCTATAGCAACATTTACATGAAGAAAtcatcctcctcttcctgctcttcttcttgctcgccaTCCTTGTCACTTTCCGCCTTGGTCGCCTC
CGATatttcgtcgtcgtcgtcctggtcgACTAGAGCCGGGGTGTGCTTAGGCTTCTCACCAGTCTTGTCTCGCTTGCTGCgggccttcttctgcttcttc
accatttCCTTCGTGggcttcttcagcaaaagCTCCACTGCCGGTCTCGCATCACCTGCCGAACTAGAATCCTTTgacttgtcgtcgttgaagcaAAACT
GGAGGAATGCTTCCGTGGGTTGCTCCTTCTTGAAACGAGCAATCGCTTCAGCACGAAGTTCCTTTTGGCGCTTCTGGTTCTCCTCCGAGTGGGGTGTGGA
CGGGAACAACGAAATGTACGGCTCACTTTTCGGGTAGTAGTAGACGTACATCATCTCCTCGCGGTACGTATTGAACTTCTTTTCGTACTCAGTGCGCTCT
GCTCCATCATCCGTCTGTAGCAGTACCCACATGCGAGTATTCCAGTCAACAACCCACTACTAAGTCACAACAAGAGTAAAGCTTCCGAACCTTCTCCACG
CGGTTCTTGGCCTGACGCAACTTTCGCATGACCTTCACACGCTCGAAAAATCGCGGCTAAAAAGACAGtcacaacagcaacaaacacATTCGTCAGTGGT
CAATCATAAATGACTCGCATCGtcagttgcagcaactcacTCTCTTGTATTTCTCTgcattcttcttctctacagcaacttgctccttcttctcgtgctg
ATCATCAGAAAAACGGAAAATCATTTCAAtacaacgtcttcttctccattgcatCATAAAAATAATAGCGACGCAGCACGCACCTcttccttgagctgct
ggagctccgccttcttggctCTCCGAGTGGCATCAGCCAGTCCCTACACGCACCAACATTGTCAGCCTTTTCGCTGAGAATAATTGCAACATAATTGCAA
AGATTTATGGACCACGCACCCCGCGACTGAGGAAGCGCTCAAGACCTCGGATGCGGTTCTTGAGCGACGGAACCTTCTTGGcttgctgcggcttcttgga
CCGAGCGTTCTTGAAGCGGAGACGAGTTCCTGGAGTATGTTAAAAACGGAGAATGCAACAGGAGGTTAGAAGACGGAGCAATGCAAGCAAGTAGAGATCG
AAGCTGCACGCACCTGCAGTCGGAGCCATCGCGACCGAGATAATGCCGCTTTGGTTGGCAGCAACCAATAAAAAAACATTTGAGCAGTGTGGCACACATT
ATCGTAAAACTCGAATTTTACATTGCAAAACCTGGCTAGTGTGAAATTTCACTAGGCTCGAAGATATTTGTGGAAGACGGTAATTGGAGGCGAACTACCT
GATCGCAAGGCCCTAATGAGGATATGTCGGTTAAAATAAACCCACAGGAGATGGGTACGTCCCGCTGGCAAAGAATGCCGTGAGCGATCTATATTATTTC
CACTATCAACCGGAAAGACATCAGCTGCTACTAAACACCTAAACACCTGAAAAAAAGCACGTGGTGTGACTCCAGAGAGAACCGAGTTGTTCGAACAGAT
TACCCATTACTTCAACGTGTTTTACAGCGAATTCCTGCTTAACAATACGAAGAATGAAATCCGTCATAATGGGGCTTTAGTTTTGGATGCATCAGCGACA
ACGCCACACGCGACTTTCGTCGCGGTGTTCTTCACGTGAGGGACATAAATGCCTGTACAACTTGAGTCCTTCCCGAACCATCTATCCCACAACCGATCAT
GCTTCGGAAGCGGCTCCAAACAAACCTCGCCGTGATAACCCAAAACCGCAAAGAATGTCGGCAATCAGTCGCTCAAAAGGTACCCTAAGACTGCCTGATC
ACTCGCCGCACTGTGGTTCAAAGTGACGCGTGCCTAAGTGGATAGACTTGAATTTGAAGATTACGTCGATCAGGTACACTCGCAAGCCAAGGATGTACCA
GGGTCACACAAAATCAGTGTGGCGAACaccactatacgtatagtcggatacgactatacacacaatggatNtcattgcatacaaactcaaagtacttcta
cgcttcctcatttctaaagcgcatacggtgcatgcctggaacagagcgctgctctcCCTGTTTCACCATCCATCTTTTATCTCCGCAATAACGAATGTGT
CAGCAGGCTGACCCAAGTCTGTTTGATTCGATGGAAAGTGGACGAGCCAAGCCTTGGTTTGGCGAGTTCGTCATGGCactcgtcttcgtcaagaTGAGAT
GAACATTTGCCCCGAAAGATGCGCTTCTGGCGTCTGCGCTGATCTCCGTCATAGCCCTTTTGTCAGCCAAGTATTCTCCAAGGACACACTGACTCACTCA
ACTCTTCGGACCTGTACGATAGAACATCGCTGGCATGTCATCAGGGACCGCTTGATCGGAGATAGTTACTCCTAGCATTCTGGAAGATCATCATCGGAGG
TTGAATGTGGCCGCTTGCATCATCTGAGATTCGGACAAGTATTGCCATCTCCTCTCCACCCGAGAGTACGTCTGCGTACTGGATGTTTTCATCTCTCTTG
AACTCCACTCAAGtgccttgttgttgttgaagttcATCGCAAAGTGAGTCTCGTCAATTTTCTCGTCTGTGGTCTCGTTGTACTCCCCAGATTCGAAACC
TCGTTTTATCTTGTCAAGATGATTGGTCACCTCGCGTTCGATAGAATTTTATTTCTGAGTGTTCTCCAATTTCTTACCCGATTGTGTTTGAAGAATGATT
TGGTGCACCCCCGTGAACGTCTGGGTCCACCTCGGGGAGATATTTTCCACAAGCAAGACGGCATCGCTATCGACGGAGTATCCATTGAATGCCCCAGTCC
TGGGTTCCGGTAGACGCAGAGCTACTTGCCGCAGTAACATCGTGCCGAACAGAAGGCCTAACTTTCGCAGACGATCAAATTCATCTAGGATACGTGGGT