Description :
From Genome Similarity Track
Location :
Scaffold_670:3415- 7465
Sequence
4050 bases(100 bases per row)
CATATCCCGCGATTTTTGGATTCCGGGGTATCGCAATCGGGTTCCGCGATCGGCAGTAGATGTGTCCCCTTGGTCCGCCCGAAGGAATGAGCCTGATCAG
CGTATCGGAGCTAGACATAGATTTGTTCTATCATCACTTTTCAAAGCCCAATGGATACATCTTCCCGGTCCAACTGGGCAAACTTCGCCCTCCTCCGGAG
TCGTCCTGGTCATCCCAGCTTTGATCATGTCGACTAAGATTGAACAATTTTACGATCAACAACCTTGGAACCATTATGATCAAACCATACACCCGATCTC
GTTAAGCCTTCTGGCTGGTTCGAAAAACTGGTCGAGGCGTATGAAGTTATCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACTCATTTCTTGTGGA
TCTCCGCTGAGCACCGTAAAACGGATCCTGGATTGGTCGCTATTGCGCGAGCGAGAAGGCAGAGAAGATCTCGTGCTGGTCCCTGTTGGAAGCGGGTACT
GCAGCTGATTCTTCAAGGCATGATCGACGGCCTCTGCGATTTGGACATTTTACTGGACTTCATCTTTCTACACTTTCCCCGTCAGAATGAGGCTAGGGCG
TGGTATCCCGGCCTATCCGTGCGGCGGACCAACATACCCAACTAGATCACTGCTTTGTCGATCGATCACGCTACCGAGCGTTGGAGGAACCAGTTTCTTC
CTTCGATAGCATCCCACCCTGGGTCGTCTCTTCCACGCTTGGTGGGTAAGTTCTTTGACCGCGAGTAATTTACTTGGTCTGTTCCATGACGCGATCTCTC
AATATACTTTCTTCTCATTTCCATTCGATCGCTCCCATGAATCGTATTTCTTCCATCTTTTTTTTCTTTTCATCTTGATCGCACCATTAAGTCTGCGATC
GTCGCACTCACTTCACATAAATCTCATTCCACCTCTATGTGCAACCTCCTTGCACCCATAACTCTCCTTCCTGTCCATGCACCGTCCCTGCATAGACCCA
TTCACTCAAGCTCTCCTATCATCGCCAATCTCTAGCTTCTTCTTCGTGCGATTACATCACCTCAAAACGATCCTTGCTCACCTGATCACGATCGAACTCC
TGCAACATGACTCCACAATTTAGATCAGCTTCATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTGTACCAGGTACTGCTTGTGTATTCGGCCATATT
CGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCGAACTCGTCCGCGTCGATATTACCCTCCCAACTGACTTCCGGCAGCAGTGTTTCATCA
AAAATCAAACCGACTGGCCTTATCCACACTCAACCCACCCGTTGGGCGTTCTGGGAATACGCGAACTAGCTTCAGCTTAGACACGTGGACTATTAGGAAT
AGCCGGTACGGCGTGCCCGCGATATCCAGCTTTACGGCGTGATCGCCACACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTCGAG
CATATCCTTTCTTGACTCGGTTCAGATATAGCCAAACTTGCGACCCGCGATCGATATCCAATAAATCTGGATTTTTTTACGTCGATCGGCCCGAACTCTG
ATCGCAGCCTCCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGTATACAATATCTCCATCTTCGGGCATCTTGATCCCGGGGTTTGG
TACTTCTCAACGGTAAGGTTGCTTCTAAGGTCGATCTTGGGTCCCAACCGTGAATCAGGTAGAACGGTGTATCTCCTCGAATTCGATCATGAGCGGTGTT
GATCGCATAAGTCAATCGCTCTGCGTATCAGTCCCAGTCCTTTTAATTTTCATCCATGACATACATCTTGATCGATCGGGTCAGCGTCTGCACCATGCGT
TCGGCCGTACCATTAGCTTGCGGTCTATACGCAAGAGTGGCCCGTTGTTTTTGTTCCGCGATCCAATGGAATGCTTGGAAGAAATCAGACATAAATCCCG
GCTCGCGATCATGGCGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCACTCCTCATAATTCTCTGCGATCCTCTGGGCAGATCTGGATGAGCTTGC
TTTTGCGATCACATATCCAGAGAACAAATCGACCCACAGCAATTGCTCGGTGTTTCCTCAAAAGGATCTTGGCAACAAAGGGATATGATCCATAGCTATA
ATCTGAAAGAGTACGTTGATTGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCTCATTTCACAATCTACACACTCTCCCACATACCG
CTGCACACTTCTGTACAACCCACGCCAATGTAAATTCGCTCTGATCCGTTGATAGGTACGGCCGATTTCTCGGTGAACACCCTCCAAACTTGTGTGGTAG
TGGTGCAAGAAGTCTATCTGTAACTGTTCTGGAAGTATCAAACGAGCCAGTTCAGTGCGATCTTCAGCTTCGGTAGCCGATATCGGACAGAAAAATAGCA
GCCCACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGGTGCGCACCTTAGCTTCAGCCACCGATAACTTAGCTACGTCTCCAAGCAGATATACCTTCAA
ATTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCCGCTGCACAACATCTTCCTGTAAAATTCTGGGCTGACATCGTCTT
CTCTAACGTGTTCGAGTGATAGCCGCTACTTTGACTGCACGATCAACTCGTTCAGGTAGTAGTAAATCGTTTAACCTATTGAGAGTAATCAGGTCCTGAC
GCTCTTGATCGAAAACCACACCTTTTCCATTCTCTTTCCGTAGAGCTTCACTCGCCAATCAATCTGCACGCTGATTCCAGTCCCGCTTCATGTGCAAGAA
CTCGTGGGACGGCCACGATCTTAATCTCTCCATAGCCCTATGCCTCAACAACTGCAGTCCCGGTGCTTTACAGTCGATTTCTTCTCGCATTTGACGGATC
ACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCGGATCGGCAAGCAATCGAAACTAAGGAGCAGCTCTCGGTATTCTGCTTCATTCACGGT
TAGATCAGGGGTATACTCGGAAGCGGCAGGCACAATTGTCCATTCCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCCCTTTCTTTTCACACTGGCT
GATCCATCGAAACTGGCTACCAGCAGTTTTCATTCACACCTACTGTGGGTGGTGGCATTCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAAT
CAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAGATCGCCTAATTTCCAACGTCCAG
CCCATCTTCCCAATCTTCTGTTGAGGCCTGAACATTGTAGTAACCATGCTAGTGTCGAATATCGCGTAAGCACCGTAATCTCACGGGATTCTAGCATAGT
ATAGCAGATATCTAGCATCCGGAGGAGAGCCAACACTTCTTGCTCCACCATCCCGTAGTTGCCCTCGTTGGGCTTTAGCGTACGACTGGAGAAAGTGACA
AGCCAATACACACCATCATATTCTTGAAGCAAAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATCACAGGCGATCGATCGGGATCGAAATGCT
TTAAGATTGAAGTTGTGGCTATCTTAGCCTTTAGCAACGTCAACGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCGGGATCGCGATCGTCCCCTGC
AATTGGGTACCGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGATCGACCCCTGCACTCCCTTCGTGAATAGCATCAGGTCTTAAAGCAGAGGTA
TGTTTTGGAGCTTCACTCACGCGGTTGATCCCATGGAAATCTGCTTCACGCAGTTCGTACAACACTGATGCGTAAACTGCAAAGTCTTCAATGAATCTAC
TGTAATAGTTGAGCCTTCACAAGAAATAACTGCATCTCTCACAGCGCCCG