Description :
From Genome Similarity Track
Location :
Scaffold_675:3415- 6084
Sequence
2669 bases(100 bases per row)
TTACCTCCCGATAGAAGTGTACGTTATGAAATTAACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCGTTACCTAAGAAACATTGTGACG
TCATTGACGATTTCTTTCGTGCAAAGCACGCGGCTGGAATGGTGCGTGAGAGTAAATCTCCCCATTCCACACCTATATTTTGTGTCAGGAAGCCAGATAA
TAAGTGGCGCATTGTCCATGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAAGATGCTCTTCAGGACAATATGGTGGGATGTACATT
GTACAGTGCGCTCGACTTAGTCGATGGGTATTACCAGCTGCTCATGCGTGCAAGCGATATTCCGCTAACCGCGGTTAGTACCCCTAGCGGTATGCTCTGG
GGGTGGCTCGTTATGCCACAAGGCTGTCAAATGCCCCGGCTACTTTTAATCGTCTGGTGACGCAATTATTCAGACCTCATCGAGGCTATGCACAAACGTA
CTTTGATGACATCTTTGTCCATAGTCATGCAACAAACGGTCGATCTGATGTGGGTAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCGCACG
AATAAATTTTATACAAATATCTAAGTGCATGTTTGGTGCAGAATAGATTCCCTTTCTGGGATACTTCATTGGGAAGCGAGGCCTCCTAGCGGACCCCGCT
AAGGTAAGGGCCATATTCGATTGGCCGGTTCCAAAGAACCAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTACAGTGCGAATTA
CGTAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGT
CTCCAGCATGCACCAATACTGGCTTTGCCCGATCCTGATAGGCCTTTCAGTGTCGTCTGTGACGTATCTGAATTTGCCATAGGAAATGCTCTGTTACAAA
CAGATGTCGATGGACGCGACCGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACCTGCTAT
GAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGCCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACCGCGACACAGTCGCCG
CATCTCTCTCAGAGAATGGCTCGTTGGCTTTCACTCTTTGCCGAATATAACTTCTAGTAAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGCT
ATCGCGCCGACCTGAATATGAGCTTGCTCACGTCACTACGCTATCATCGTCAGTCACTGACTTAATCCGGGCGGCTTACACCATTGATGAAAAATGTGTA
GCTTTGCTACGTGCTCTTGGGAGCAAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTGCATCGATATTCTATCGATAATG
TCCTGTTGTGATATCGCACAGATATTGAGGATAACTCTTGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATAC
CGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTTAGTGGGCCAGGCTTATTGGTGGCCCCAACTATACAAGTGGATGAGCACCTATGTGCGT
ACGTGGAAACGTGTCAACGGTTAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGAGAGTCCATGAGTATGGAC
TTTGTGTTTGGCCTACCGAAAGATTCGGAAGACAACACTGGCATTGTGGTCTTTGATGACCAATTGGGCAAGATGGCTCATCTAGCGGCAGTGCCGGATT
CTATTGATGCCGAAATTACATCGAAGCTGTCTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCAC
TGGGAAGTTTTGGAAGTACATCTTCAAGGTTCTCCGCACCGTTTGGACATGTGCACAGCGGATCATCCGCGGACCGATGGTCAAACTGAGCGTGTTAATC
GCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGCTCCATGCTCTCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCA
TGCCTCTACATGCTATACTCCTTTCTACGTAAACGGTCCCCCCCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGA
GGTTGCCGATCGGCTTGCTGATACCAGCCATGCTACTGTTCAAAAACAAGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTACGACATTTGCGTGAC
GCAATGGCTGATATCCAAGACAATTATAAGGAACAAGCGGATGCTAAAGGCAGAAGCTGTATTGAAAGTTATGAGGTCGGATACCAAGTCTTACAAAACG
CTAAAAACCTGCCTTCAAATGTAGTGTCCGCTGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATTGGACTATTCACGATCGTTGCTAAGAAGGGACTTGC
GTATACGCTCAACCTTCCACGAAAATTGTGCACACATCCTGTGTTCTACGTTGGCTTGCTTAAGCCGTA