Description :
From Genome Similarity Track
Location :
Scaffold_1644:3415- 5677
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh-par_contig_1644-abinit-gene-0.18Dual specificity mitogen-activated protein kinase kinase

Sequence
2262 bases(100 bases per row)
CGCTCGACTCTTTACTCTTTCTCTTTTTCATCTTGAGTTTCGTGAGCCCGCTTTGCAGCTTTTTCCAAAATGACGAGCTGCCTGATCGGTCGTCGTCTGC
AGCTTGTGGGCTCTCGCTATTCCTTCCAAACAGTTGCTGGCGGCGCACGTTTCCGGGGGACGCCGTCCAGCTCTGCGGCGAAAAGCAGTAGTCTTCCAGC
AGTTTATCGTTGTAGGAGCCTCGTCTCTGTAGTCAAACAACAACAGCAGTACCCGTTAGCCAGTCTCGGACTGGTAGTTGAACACAAATGCCGGGGTAGC
ATTACCGCTTCGAAAAGAGTGTGAACTTGGTGCACCGGCAGGCCAAGGTAGTTGGCGAGACCGAGTTGGAGACTCATTTGAACTGGTTGAATCGAGACTT
TGCGGTGTTGTGAAGTCTGGCTCGAGCGCCCCGTCAACGATGTCCCATAGTCCGACTAGCAAGTATCATGACCGAGTGACCTCAGATATGTCAGCGTTTT
ACAATCAGATGAGATCGCGTACCTGTGGCTGAAAGGAGAACTTCGCGTTTCGCTCGTATAGGTGGCGATACACGGCTTCGCCCAACGATTCCAGCTCGGC
CGATCTATCCTCGCACAGCTGAGAGGCCTCAATGAAGTTCACCCACTGCCGGCAAAGACCAATGTCAGCATCCCGTCTCTGCTCTCTGCCACACCCTATA
GGAGCCAACTCCACGGACCTCATCCAGCGTTTCTTCCTTGGAGTATTTTGTCAGAAAAGGATGGTGAAGCAACGTATCTGCAGACGGACGCTCCTTCGGG
TCAGTCTTCAAACAGAGTTTGACGAAGTCCCGACACTCGGGGGAGAAATCATCTTCGGGAAGATTCAAATATTGCTCATTCGCAACCTACAAAAGCGAGT
TGGAGAGATCAGATACCCCAGCCACGCAATAAGATTAAGCTAGAAGTCTCACCGTATCGACGAGACCAAAAAATCCGTCTTGCGTTGGGAGAGGATACTT
CCCGAGCGCGACAGAGACCAACGCGAGACCGAAGGACCAAATGTCGGCAGGATACGAGTAGTCGCCGCCACCGATTCGTTCTGGCGCCATGTAGAGCAAT
GTGCCGACAAACGTCTTGGTCATACCTGCATTATCGTTCAGGGTCTTGGCCAGCCCAAAGTCGGAGATCTTGACTTCTCCTTGCCGATTCGTGAGAAGAT
TGTGCGGCTTGATGTCGCGGTGGACCATGTTCTTGCTGTGGATGTGGCTCAGGCCCTGCATGACCCCCGCGGCCAACCGGGACAGCACTTTTTCGTTTTG
GCAGCCACCACGCAACACGATATCTTGCAGCGAACCGGCACTCATATACTCCATGACGAGGCATATGCAGTTCTTGGCCCTGTCGACATACGCATCGTAA
AATGACACAATGTGCGGACTGGCTCTGCCAAGTACGAGAACGTCACGGTCAGAAATTCAACGGCGGCAGGCAGATACAAATCACGATAGAGAGGATCACT
TACCTCGGCCGACCGTTGGAAGGACGCCGCGTGCTACCATTTTGGATCTTCGTTTCTTGCTCGTCGTTGGCAATCGGGACCAGGTTCGAATATAGAGCAT
GGAGCTCACGGACCATTTGCCGTCTCTGCCCACGTCCATATACTGGGACATCCTGGCAAAATCGAAACTCATGTCACCACACTATGTCTCTCGGATGGAT
ACAGTCAAGAGTCGTTCGTTACCTTGACTGCCACCACCTTGAGCGTTGGGATATGAATCGATTTGTACACGACGCCAGAGGCGCCTCGCCCAATTTCTTT
GACGCGCTCGAGATTTTCTTGGAGATGAAGCGACGCCGAGTCGGGCGATGAGATCCCGGCTTCGCTTACGGCCACCATCTTGGTCGTAAACATGCCTTGG
TTCGGCGAGTACGCACTACCAACACTAAAGCGGCCTAGAACCAACAACAGATTCCTTGGTGAGAATCTCACCAACTATCGCACTCCCCATCCATATTTTA
CGACGAACCTGTCGGAGACGCAACGTCAGACTCGTCGCCAGAGCTGTACGACTTAAAGTTGAGCCGCATCATAGCCTGCTGGGTCGCGCTTTTGGCGGTG
TCCACTCCCACGGGCACGTCCCCCGTCGCGTGGGCCTCGTTCATGGCCTTCTCGATCGCTTCGCGTCGTGCGATAATGCGCGTCGCCGCACGGTTCGCTC
GGTCTTCGGCTTGCTGCGGCGTCGGCATATCCTCGAGCTTGAGCCGTAGCATCGGGCGCTTG