Description :
From Genome Similarity Track
Location :
Scaffold_18:34148- 48900
Transcript NameFunction/comments
Hyaar_Emoy2900112HaRxL129a2

Sequence
14752 bases(100 bases per row)
GTGCACTGGTATATTACATGCCATGAGCGTTCGTGGACCAAGATTTCAGAAGATACTTCTTCTTCAATGCGTACTGATTACATACAGATCTTCAGTACTC
TCTCATTGCTCAGAACACGTTACTCTAATGAAAACATTGTCGTCGTCCTCACTTAACATTTGAAACAATGACCCAGCACCAGTTCATGCGACATTCGTGG
GCGGTCGCATGCCAATTATCGAAGTCACGATCAGAGTAATGAAACCTTGTTTCCAAGCTCATATCGTAGGCAATAAAATGAGCTTTGATTCGTCGGCTTG
TTCGAACGGGTATCGTAATTTATCTCACATCAGAATAAAACTGCTGAATTCTACAAATCGGATGCTGGGACAACAGCCATTAGGGATTTTGGAGAGAGAT
GACAATAGCTCGTTCGATGATTCTGCAATACAAAATAGCCGTCAAAATAACATTGATCGAGTGACAGTCGAAGTCCGTAGGATCACGTACAGCACATCGA
TGCATCGCATGCCTTATCATACCTTTACACGCTTGTTCGACCTCATCCACTTCGACAACTACTCTGCGCAACTTCACTGATCTCAGTATCACAGACCGCA
GGTGCAAACGTTGATCCGGAAGAAATGGATCGATCATACAAGAACAGCTCTGCTTTACTACGAGACTGACCAGTTCTCGTAATTGCCTTACTTTACGTTA
GACTCTTTGTTCATTACTTTTACGCGATAAGATATCGAACTCTTCCTGTCCGAGAGCGCCGTCGAGCTGAACAGCATTCAATACACGTTGTTTTCCGTCT
TAATTGTCGCGAATACCATCCGCACAAAGATATGACAATAACGGCCTAGTGAGTAAGCACTACAGCGACTCACCTACCCAGCATGAATCGATTACAAATC
CGATACGACCCATCTTACAGCTTATAGCTTACTGCACAGACTTTATGGCCGATCGACACTCGCCTCTCGGTAGTATTTCTAGCGTTGTTTAAATTCCGTA
GCAATGCAATCTTTAACCACCGCAACAATTAAGCATACTTGCGTCGTGCTTGACATAGTAAGCCTAATCCGGCTATTACCGGACAATATCTGTCGCCAGC
TGTTCATTACGCTGTACTAATAACCGAAGCGCAGCTTTGTCTCAAGCTATTGACCCCGGCCGTAAAAAGCGCTGCGTGTGGTTACTCATTTTGCCATGAA
ATGCCATCTTTCTTGGTGAGCGCTCACGTCTAAAAAGATACCCCACGAAAGTCGTACGGCGAAAGAACCAACAACTTTGGATACTTTTTGTAACGTGATA
CTTGCAAAGAAGCAAATTGTTCTTGTTGAAGTGATACCATCAAAGCATTCTTATAGCAGCTCCAAACCATCGTGAACCTCCTCACCACAAAAAATCATAT
GCAGTATCACTGGGAACAACACATATTCGGGTATGCAGCAAAAAATCCGAGACCGGCGTGCCACATCTCGATACGTTGTAACGACTAGATCGTCTACAAC
AGTCAACAGAAAGATGCAAACCACCACAAGCATTATAATCCAATTCACTTATCCATAGACTTGCCTTGACGATATCGTATTGAGCTTAGTTATAATGATA
AGAGAGCAGTCGACACGAGTATGCTGCAACGCTTGCACACAATGTGCCATCCCGTACCTCGAGTTGAGTGTCAAAGACCGATGAGCGCATTCTTCATTCT
CAGCAGCGTTTAATTCAATATAGACTTGCCGCTGCCTTGTGTTTCAGACTTGTTACATAGCAATTAGTAGAGCGATCGATTCTACGGATGATACAAGGAG
AGAGAATCGAAATCGTGGCTTTCATAGACTGTACGGAAGGAAATATGTGCCACGCTTTAATATTTTTGTGACTGTTTACCAAACTTGATTACGTCTTTAG
GGCTTAAAATCATACGTAGAAACAATATGCGCTCATACGTGAGCATGTGACTTCAAATGTGGTCGTGTAGCTACGTGTTCGAGTTTGTAGCATGCAGCAT
CATTGTATCGTCGTTCCGACTTCAGCTACAAAAGTGGTATTTAGGACTCCCGTAATGGAACCACTCACTGTATCACTTTTCTAGTTTCTGTAAGTCGGCT
GCGTCAGGTCATTCGACTGAGGAGTCGATACAGACGAACGTCTGAATTCAATCGCTCCGTTGCCTCTTCAAACAAATTGGGACTGATTGCACCACTTTTG
AAGCAGACTCGTTGCGCTGAACATCGTACTCTGGAAGACAAAGCAATGCATTTGTCACGGAACATCATCGACAAAACGTTTGGCTCATCGTGGCGGCAGA
ATCAACACTTCTATTCACATTGCAGCGCGTCCAGAACACAGAGTGGCACAATGCATGCCTCGTTAGGCGTTCACACATCGACATGACGAATGACTAGGAG
CCGGAAAGAATGAACCGTAAATGAGAAATCATGCACGTTGCAGCTCTACGTAAACTTTGCTTTGGGATGATTGAATATGTTTATAGCGCGCGTATGATCC
ATGTCAAAAGACTGCCAAATGATCGGACTAGACCTGAAGATTCGCCGCTTATAGATTTGGTCTTGCCGAACATCTTTAGAGCGTCTCCAGCAGTGAGTAT
AACTTAACTTTTTGTGCACTAACCACAGATTAGTATAACTTCCTCTCAAACTTATACGCAAAAAACTTGACTGCGGTCAGTGTAACTATAGGATGATATA
AGTTTATTTCGGCCGAACGTGACTGGTAAAGTTGTGGTCGCCTTGGTTTGTATTTTTGGTCCCCAGTTAGGCTCAACGGTATAATGTTGCTAGTGTCATT
TAGAACCACGTCGTCGACTTCAAATCATCGTTCTTCTCTATCAACTGGAGCCAATGACATGCAACTTATCTTCGCCAATGACCTGATTGATCTCGAAATT
CTGAGCCAATGACATGCAGCCAGAAAGGTTACTTCGGGTGTCACAGAACTACAAAACGTAGGCAGGATAACAAAAAAATAATGTCCTAGTTAGGGGGTGT
TAGGGGGTGTGGGGATAGCAAAAAGTGGGTGGGTGGATAACATCACCCAAAAATAACTTTTTCTCGAGTTATCCCCGAGTTATTTCGCTGCTGTGGCGCA
CTTTTATGAGTATAAATAAATAACGTTTTTTGGTTGAACAGAATGTTAAGTTATACTGACTGCTGTGGATGCTCTTAAAATCTATCTGCGTCGCTCAGGT
CAATAGCAAATTTAATTAGACTGATCGGATTAAGCGTCAACACGATCTACGACGTCACGCAGGTGACGCATCAATATCGTTTGACACGGCAGGCGCAGAA
AAGTCAAAGAGCGATAAGCGACGACAATCGGTCATCTCGTAATGACACGAAGCCGTGTTTGTGTGCGCATTTTAATTTGCCGCATCATCGACGAAAGGAA
TGGATCGCATTGAATGTCATTGTACACTTGTATTCATACCTCAGTAATCATCGAACTTCCTTCTGCGCGTGCATTACGCATGCTGCAATCGCTAGTGTCG
TGTGAATTACTGGGAATTTCTCTTCGACATCTTGAGTCGAGGCAAAACGTGCTTCGCAATGATACCCCTTCTGTATCGATTAATGGATACACCGTCGACA
TGGGCTCGTCAAGGGATTATTCACAGAGAGTTGGTTTCGATCTCGCCTTGGATATGAACGCCGCATTGTTGGACAGCACTGCCGCAACTTTTCATCTTAT
CTGTCTGTCCACTTTTACTCTTTTTAGAGGCACGTCAGGAGGGGGTGAAAGCCGGGTGCGCGAAACGATGGTTTGGGTTAGCAACCCACCTGTGCTCATC
TTTATTGACTTCACTTCATTCTAGTAAGGGCGTCCTATCTCGATGCAGCATACCCATCTCTGATCTGTGTCAGTAGGATTCTTTGCCGTCAGTCTACGAC
AGCACATCATTGGCTCTTCGCTTTCATTCTTCAAGCTCATTGCACAACTTGTGTGGCCATCCGCAATGCGTCTCCGCTCCGCTGTTCTGCTGCTTGCTGC
GGCCGTAACTTCAACAAAAACCGACGCACTCCAGGCCGGCCATCCCTACTCGCGCGGTGTAGACAACACAGACGATCCTGTTCAGAGGCATCTGCGCACG
GATCACAGCGAAAGCGAAGAGAGGATGTATTCTGGTTTTAATACGTATAAGGTTTTTAAAACGGGGCCACTTATCGATGAGAAGCGAAATACGTCGCGGC
GGGAATGAGCATTCCGAAATTCGTTTCAGAATGGGGCTGTATTTGTAACGGGGCACCGGAGCAACACACTGGACAACCAGTGCAGAGCTACTACCACAGA
TAGTAGTGCTAGTGGTGCCTCGCTACCTCTGTTAATTTGGCAGAGGAAGGGAAAGCAACTAGAGACAATCTAGTTGCTGGTAAAAGTAAAAATGTATCAA
ATATAATTAATTCCTAATCATTAACTTATGTCTTAGTCCTAACTTGATTATATTTATCTACAAAAATGTATGCTGAAGTCTTGCTCACCACTCATTGCGC
GCGTCCATCGTTGATTGGACCGCTAGAGCTGGCTGATATGATGACCCATATCAGCCAATCAGTGAGTGTTTCTATATATTACCCCTAATGGTAATATTCA
CGAACATTATCAACCTTTTGGATAATATTCTGATTAACAAGTATCAAGGGTTAATTACATGTGACAGGCTCACCCCGTTACATCACCCTCCCTTAAACGA
TAGTCACCCAATCACTATCATGTTGATGTGGTCACCGTTGGACCACATCAGGGACAGGGAGCACTTGATGGTCTGATACATCCATTTCTGGATTTTCATC
ACATGGTGAACAATTCCATGCGATGCGCGTGTTGACGCAGCTGCTCTTGATGATGCCCAGCCTCTCGCGGCAGACGATGCTTCGTCTGCTGCCGCTGCAA
CTCTTCCTGCAGCACCAGTTGCTGCAGATGCACGTGGTGAGTCACCACATGCTAATGATGATGACTCCCAAGTGGAGCTTATCTGTTCGGGGAGTCGGAA
GGTGGGTCCGACTCGAAGAAGACACCCAGGTCACCCGAGTCTATAGTGGCGGCCGAGTACGAGCCTACGAATAGGACTCGAGCGGGCAGTCAGACTCATG
ATCATTACCGGAGTCTGTTTAGTTCGGAAGATGAGCATGCTGACTCATCCCCCGCGCCTGGTAATGCGCATTCGCCTTATAGCGAATGCGGTGATGACTT
GTACCATCATGATGACAATTCTAGTGGTACCAAGACTTCCGTTAGTACCACGCAGAAGTCTCTAGACGGCAATGTGCTGTGTCTATCCCCTGAACACAAG
CCTTTGGTGTTACCAGAAAGGCTTGTGAATGACCTGTCAGGCGAGACAAGTCTCCATAATCGAATCCCATTATTCGATGCGAGACTGTTGCACGGGCTCG
ACATCAGTACTAGTAAATTTCGCGCTGAAGAGGACTTCTATATGGATGCTTTACTGAAGCATCGTTGGTATAGTGGCAACACTGAACGAGACAAAAGTTC
GTTGCTGCAGGCGTGGAACGCCTTGATACTCAATGTGCAGCACATGGGCGCGAAGCTTGGCTTCGGAAACTTGACACAGCTCGTGTTAGGTTTGAGAAAC
GAACCTTAACTGGTGCAAAATCCAGGTTGCAAAATATGTCTTGTGAGGCAGGATTTCCGTGCCTCACGTGGGGCGACCCGTGTCCGTGTTGTTTCGACAA
CACCCAACGCATCCAAAGGGAAGTGTACTCCCTTTCTTCGACCTGGGGTAGGGCGCACAACTCTTCTTAGATGCGCGATGCGATTGCTAATCTGCAATCG
CTCTATCAGCGCCATGGGCGCGTGTTTTCCGATTGCCCTTCTGAGCCATCGGATGTGTCTCGTCGTACTGGTGGACGAGACCCTCAACGTCAATCATCAG
CTGGGCGCGAGGCTCCCAGCTGTCGCGCGACGGCGAATAGCCGCGCCAGCGAACAAGATAACTCGTTCGCTGCCCCTTCACATCACGGTGGTTCAAGATA
CGCTCCACGTGAAAGCGTTGACAACCGTGCGAGTCCACCAATGGCTGTGGTGAGGACGGGAATATCAACTCCGAATCGTTTGTTAAAGTTGCAGGCGGAA
ATTGTTCGTCTCCAGCAACACTTACACGATCTGTGTGATCGCACCGAACAAGAGAGGCAAGAGCGTCTCTCTTTGGAGGCGTGGGTGCAACGCATCTGCC
TTTATCGATAGGACGACCGATCGGAGTTCGCGTTCTACCAATTGGAGAACGAGGGGGCGCGCCAAGTCTTTCGCGACTAATTGGCTGACCTTCGTCACCA
GAATGCTGCTCTTCAGAGCCAGGTTGGGAAGCTGGCTCGGGACCAAAAACATTTCTTGGATATTCTTGAACGTGGCGGTTTTATTCGCCCGAGGAAGAGA
CCTCGTGATGATGGTACGGGCGGAGACGACCGACATAAAACGTGGGATGCATACGCATCCTGCGAGGTAACTCGATCGTGTACGCATTGCCTTTGCGATG
TAGTATACGGAACGGGCCGATGTACTTGGGTAGTAGTATACTACTACCCACATTAGTTACTACGTGTTTAGGTATATTTACGGTAGACAGTAGGACTAAG
TCTCCTACATTAAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCGTTCTGTTAATGCTGGTCTACCGCGTTAGCGATGGAGTCTTGCACGAAATGGA
CCACTGCTTCTCGTGCCAGCAGGAAATCTTTTGCTGAATCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGTGCCCGCTAGGAGGTCATCCTCTTTTTTTA
GCGAGGGTGTTCTCATCCTCGCTGGTGTATTCATTGGCGATACTGAATATACCAGCATCATCATCCTCATCCGGGTCAGAAATAGTGTCATCACTATTGA
TAAGGTTATCTTCTTCGATTTCGACTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACCTTGACACGTGATGAGCAAGAGCCAGAACGGTTTTTGCT
CGAGCAAATCCCTCCTCCCCTTGAATTGGTGTCATACTCTGAATGGGTGGGTAGGCGTGGATGGCGTAAGCCATTCACGAAAAATGGTGTATGCGTTGTC
GATGCATGCATGGAGTTGTTGATTGCAAACTGCACCATCGGCAAAAATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTTGAAGGATCTCTTCGAGAA
CGGGGTTGACGCGTTCTGTCTGAATATAAGTCTCGGGATGGTCAGAAGTAGACATAGTCAGACGTGTTCCGAGGGATCGCGCACAAACTGATACTGCGGG
GCCAGTAAAAGTCGTGACTTACCGCGAGATAAGTCTTCTCACGCCCACGATGCCCACTAGTTGGTGCATTGTGGCACTCATACATGATGCGTAATAGCAA
ATCATTATGGGTGGGGACGACGAAACGAGGTGTGTTGCCGTTAACGGACGTATAATACAGCAACTCGTTGCGTGTTGTGTATCGACCCGCGGAAGACCGA
TACAAGGCCGATAATTTTTTGAGAAATTTACGAGATGGAGTCACCAGATGATCCATTAGTCGCAGAAGAGCCTTATCTACTGCATAGAACTTTTTCATGT
CGTCAAGCAATGTTGTCGACGGAACACTAGTGACTAGCGTTGCAACAGTTTTATCAACCCCACTGTTGGACTGCGCAGCCGACTCGAAATCGGGTGGCGC
GACAACATTAAGTCGTCCGGGTTTGTACTCCACGGAAAAGTTGTACTCCGCAAAGAAGGACAGCCACCTCGCCATCCTTTGCGAGAGGTGGGGGCTGTCT
ACGGCCGTGCGTAATGACGCATGGTCCGTATAGACTACAAACGGGCCTATCTCCAAGGAGATAGACGCGAAACTTCGCCAGTGTATACTTCATGGCAAAG
CGTTTCTTTCCATGCACTCGATAATTACGCTCAGCTGCTTGCAGCTGACGCGATTGATAACAGACGACACGCTGTGCGCCGTCTGCATCGTACTGCATTA
ACGCGCAGCCGATTGCAAAATCGCTGGCGTGACAGACCACATGGAATGGTCTGTCTTGGTCTGCAATCGCCGTCTTGGCGATTGCATCAAGCTCTGCTTG
ATACCTTAAATGAACGCTGACAATCAGAATTCCATGACCACTTCTCGTTCTTTTTTCAAGAGACGAGAGAGATGAACGGTCATCTTGGCGTAGTTGCGCG
ATTACTTGTGTAAGTACGTCGCTAGACCAAAGAATTTTCTTAGTCTCTTAACGTCGACTAGCACAGGCCGGTCGATAATCGTCCTAATTTTTTTAGGATC
AGGGCGTACGCCGAGTTTACCCACGATGCACCCAAGAAATGGTATTTCGCTAGCAGCGAATATACACTTCTTGAGGTTGGATATTTCTGCTCATAAGTGT
AAGAACCTGACGAACGTGAGTTCTATGAACCTCTACGTCTGCATTTCCGCCCATAGCCCGTCTATGGACGAATACATCGTCGAAGTAACTCGGTGCTAAG
TCTCGCACCGGTCTCAACAGATTTGTGACGCATCTATCGACGGTGGCAGAGGCGTTACTAAGCCCTTGTGGCATTAATAGCCACTCCCAGAGCATACTGC
TCGGGGTGCTTACTGTCGTGTACAGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGCCATCCATCAGATTCATGGACGAAAAGATGGTACTCTTTGA
CATACCATCAATGATTACGTCTTTCTTCGGTATCGGCGTCTGAGTCAGTACCATTGCAGCATCCAACTTGTTGAATGCGTGCACTATCCGCCATCCTCCG
GTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGCGGAAGTTGACTCCCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCGATCGCAA
GTACTTGCTCACGAGTCAGTGGCCACTGCTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCGATTTCATGTCGAGTGCCTTTATCCTTAGGCAATTC
GCATGGTACGGATTCAGGGAATGCATCCTTGAATTCGATCAAATCCTTATATAAAGGATTTGCCTGAAGCGACTCCCAAGATTGAGACGTGTGTCTCTCA
ATCCAAGTCTTCTCATCGAGGACACTTTCGTCCATTGATGAGCTGCTGATAACTCGTTCGTTCTCTGCAAATATTACTGCCTACCGAATGTCGGTCACGT
ACTCGTCCTCCGTGACGAGTACATAGATCTGCTTGATCTTGCCACTACGCAGATCTCGCAAGAACCGTTTCGGTTCTAGCGTTGGCAATTGAATGATCTT
CGAAGTCAACTTCGGAGGCGCGATCAGATCAAGTGTATAAGCGCCTACAATTGACCCGTCATTGACCAATACATTCAATGTCTCGTTTTCTTCCTGGGAA
CCCTTTTCCTCAAGTACGTGGGGCCTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACAGCTATGTCCGCTACGATCGACTCTCCAGTCGATCT
AGGATCATCGTGTTGCCCTGTGTGGGCAACTGGTATATTCTTACTTGGATGTCTCCCGCTAGGCGCACACCTATGTCCCGATGCACTCGACTTGTTCGAG
TGGTGGACCTTCGGCGCTGCCTGTGTATCCGCACAGCCGCCGGCAGCTTCCTCCACAGTGCGATTGGTTGTCACACTGTGATCTTGTGCAGTCGTACTAA
CTACCGTACCGCAAGTGAGGCCATCGCACTCACTCACAGTACATCCACACGCTTGTGGACGCTCCAAAACGTTCATCAGATGGCCATCTGATGAACAAGT
GGCAGGCATCTTCGCGGTTCGATGCTGCCAGCTGACCCTTGACTCGTACCTTCTGAGCCAGGGTAACCCTAGGATGACATCAAATTTGTCATCCAAATCA
AGTACGATGAAATCATCATTGTACTGCAAATCTTCTAACGTGTAGTGAAATCCCACTACACGTTTCATCATTGCTATCGATGCGTCTGTTGCGAGGCGCA
CCGACAACCTCGTAGGAGGAGTAACGCGCTCAACGGACTTGAGCCTACGATCCTCTATCGACTGGCAACGAAAAAAGTTGTTCTACGAACCACAGTCAAC
TAAAGCACGAAGTGACAAATCTTTTGTCAATTCTAAATTCAAGGTGATTAGGGATACCTCACCAAGTGCAGAGACACACAAGTATTGTGAGTCTGGAGCA
ACTTTCATCAATAGATTTGTAAATTTTGCAAATTCTATTGAGATTGCTGGATCAGTAGGGAGCTCCGCCCCTGCTGACCCCGACCGTTTTTTTACGGTCC
TCTACGCTGTTGTGACTTCGCAACAGCGTCGGACCCGCGTCCGTTGCCCTTCTTGACAGGCGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCGT
GAAGCACTACACCCGTATGCGTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGTTTTGAATCGCTAACTGCTTGATGAGCGAGGTCTCTCGTTCTCG
ACACTGCAGAGTTCCATTGGTTCTGTACCTCCCGCCTCTACTGTCTCGAAGGACGATAAGGGGTCAAGCTAGTGTAATCCTGTCTCACACTAAAGTCCTC
TTGCACCGCAGTTGTAATCGATTCCTCAAGCGACTTCAACTTGATGCAGAATACGTGGTTCCTCACGGGACCATCTATAAGGCCCTGTAAGAATATCGTG
ATCAACACGAATTCACTTACAGGGTTCGCTACCATGCAACTTGAAAGGTAACGAACGTGCTTAGCGCAAGCGTTAACGTCATGCTTACCTTGTTTTATCT
TCAGAAGCTCTGAAAGAGTCCTGAACTCAGCTCTTGGCGACTTAAACGTTTGGCTGATCAGAGTCTTAAAGACCACCAGCGATCTAAACACGTTTGGATA
TTGTAATTAAAGATGCAGGGCCCAAGTTCTGGCACGCCCTGAAAAATTCGATTTGGCAAATACAACTTGCATTTCCTCATCGTCGATGTGGCGAGCCTTA
ATGGCATCGTCCACTTCGAGGACCATCTCAACAGGGAGTCTTCTTCAACTCCTCGGTACTTGGAGAATACTAACTTTAGATTCTCGCGTCGACGCTCACG
TGTCGACGCTGGAATAGCAGACAGAGACTATTATTGTCTCAGGGGCTCAGTCTGATGATGACCGTGCTGGTGCAGCAGGGTTACTTCAGCTCGCGACGCG
TCAAGCCCTCGTTGCAAGAACTTGGCGATTGTGGAATGCTGTTGGTTCCTATCCCTTGAGAATAGCAGAGACCAGACAGCTTCTTCGCCAACAGTCGAAC
TCAGTCTTTCGACCGCACTCCGTTCGACATCACTCAAATAGGAGTGACTTTCATGGGTGCCGTGAAAGGTGTCGTCGCCTTCGTCGTTTAACATGTTCAT
GATGAACGGGTTTTGTGGTCCTTGGACGGACTACAAAGTGCTACCAGGTGTAACGGGGCACCGGAGCAACACACTGGACAACCAGTGTGGAGCTACTATC
ACAGACAGCAGTGCTAGAGGTACCTCTCTACCTCTGTTAATTTGGCAGAGGAAGGGAAAGCAACTAGAGACAATCTAGTTGCTGGTAAAAGTAAAAATGT
ATCAAATATAATTAATTCCTAATCATTAACTTATGTCTTAGTCCTAACTTGATTATATTTATCTACAAAAATGTATGCTGAAGTCTTTGCTCACCACTCA
TTGCGCGCGTCCATCGTTGATTGGACCGCTAGAGCTGGCTGATATGATGACCCATATCAGCCAATCAGTGAGTGTTTCTATATATTACCCCTAATGGTAA
TATTCACGAACATTATCAACCTTTTGGATAATATTCTGATTAACAAGTATCAAGGGTTAATTACATGTGACAGGCTCACCCCGTTACATGTACGATTTTC
GTGGACTAAAACGTAATCGAACCTGATTTTGGAAGATCTCTTGCTATCGGGTTTAAATAAAACATTATAAAAAAACGATTGTAAAAAACCACTTGGGGGG
CAGCCCTGGTGTGTCAGGAAGCCTTTGGGGGATGAGCTACTCGCGCAGTATAAGTGGCTGTAATCGTGTACCCTGTGAATCCAATCAGAAGGGTGCAAAT
GTCAGTCGAACGCTCGAATCGGTAAACATATGGAAAGAAGTTACAAAAGGACCTATCATGACTTACCGCCGTGCACTTACTTACTTGTCATGGTAGCACG
GAAGTCGACAGCACGAGTCTCTGTCCAGCTCCATTGTTGTACACCGTAGAACTTGCAGGACATCGAAGTTCGGCGACAGAACCCCATTTCGGTCGGAATT
CGAGATAGATGGAAGCCATCACTCGCCTTTCTGACGTCACAACGGAAAGCAACAGCGTCCCCAAGCACGTACATGGCGAGTTGCTATATTTGTACCAATT
TTGGTCCCATGCAATGGGATGAGTCCGTTTCATGGTATTTTGCATAAGGTGAATATCAAGTGCGAATATTTAGTCATTAAGACATCATATTCTTACAATA
TTCTCTCAACAGGTAATATTGTGATGCAGAAGTCATCAGTTGTCATTGGTTAGTATAGGAAAATGATAGCAACCACTAAAGCCGAGCCACGGAAGCCGCA
ATGAGTGGTGAGGAGATAGTTAGAATACATATTTGTATTAGGCATAGCCAAAAGAAGCCTATATAGGATTTATTAACAGAGGATTAACCATACTAAATAC
AGTTCTACTTTTTACCCCTATCTCGCATTGGAACCTTCCTCTGCACGATACGTGTACGTGATGTTACGAGGCACCTGCGTCCGCTGAGTTCGGATTAAGT
AGCTTGTACTGTGCCAGTACAAGCGACCGGTGCCCCGTTAAACCTGGTAGCACTTAGTAGTCCGTCCAACGACCATGAACATGTTGGATGATGAAGGGGG
AGACTTCCACCCCACGCATTAGAGCTACTCCCATTTGAGTCAAATTGAATGGGATGCCGTCGGACGCTTGAGTTCGACGATAGGGCAAGAAACCGTAGGC
GCTATGCTGTCCGCTCTGGATCCAGACGGGCAACACGCCACCATCGCCAAGTTCATTCAGAATGAGCTTGACGCTGAACGGGAAAAAAGGACATTGCTTA
ACCAACAAGGGTCTTATCAATTCGAGCTGTTGAGGCAGCAGCAGGCTGCTGCTACTGGGTCGACACACGCGTCGACCCGAATCGCTGAAGATTGACATCT
CCAAATACAAAGGAGCTGAAGATGACTCTCTGTTGAGATGGTTTGTTGAGCTAGATGACGCCATAAAGGCTCGTCACATCGTCGATGAGTAAATGCTGGT
CACATTTACTTAATCGAACTTGGCAGGACGTACGAAGACTTGGGTCTCAAGCTTCACAACCCATATATATATATATATATTTAGATCATTAGAAGCCTTC
AATCCCATCTCAGACAACCTTTGACCACGCGAGCTGAGTTCAGGTTCGCTCTGACTCCTGAAAATCAAACACGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN