Description :
From Genome Similarity Track
Location :
Scaffold_45:341423- 345276
Sequence
3853 bases(100 bases per row)
TTAGTGAGGACTTCAGCGAGCATGAGCTCGCTCTTCACTTAGACAGGCGCCACAATGCCACGTCGCTCTTGGTCGCACAATTACTTGACGCGAACGTCAA
TGTGCTTCACTTTCGTTGACGTCGCTTCTCCTGCTATCTGCACAATTGCCGCCTGGTGTCAATGTACATCGTGAGAGCCAGCGTCGGTGTCACGCCGATC
TCGGTGAGTGTCTCGCATATGCCGATCAGCTCGCGTCCGGCTTCTCACGCCGCAACGAACTCCGACTCCATTGTACTTAGCGACACGCCTCCTTGTTTCT
TCGACCACAAGCTCACGTCCATGCCATTGAGCAGCACCACGCAGCCACTCAGGGACTTCCAATCCAACCTGTCTGCCGCATAGTCGGAGTCGCAGTAGCT
GACAAGCGTTGGCTATGCTTCCGCTTCCGTTGTTGCTGTCTTGAGCGCTTGCGTGTTGATCAGATAGAGAAAGATCCTCTTTGCAAGCTTCCAGTCCTGC
GTGCGGGGCGCGTGCGTCTGGCGCGTGACTTTGTGAACCGCAAACGAGATGTCGGTCTTGTGCACCTGGCCACACAGAGCAGTGAGCCCACTAGCGACTG
GAACACACGGACGTTCGGCTGTCCTAGCGCACTCGTGACTGGCTGTAGATCGCCTTCCGCGCTCGCTACATCGTATCAGTCTGCTCCGATTGGAGCTCGC
ACTTCGTTTGCATCGTGCATTCCAAGTTGCTGCAGAATGTCGATGATTGCCTCCTCCTGATCCAGCATGTACTCACGCTCATTGCGGTGAGTGGCACGCA
TGAAAAGGAACTTCGACACAGACCCAAGGTTCTTCACCGTGAGGCACTCGAGTCTCACAAAGAACGCCTCCACAGCGTCGCTTGTCGTCCCAGTCAAGAG
AAGATCGTCCACATAGACTCCGACAATAAACACGCCAGTCGCGTCGCGCCGGTAGTACAAACACAAGTCGCTGATGTACCACTTAAAGTCCGCCTCCTCG
AGACGCTTGAGGAAAAACCGGCTCCTTAGCCGCCCCGCCTGTTTCAGCCCATAGAGGCTTTTCTTGAGCTCGAGCACGACTTCGGTATCGTTGTCCACTC
CAAGTTCCTTGAGCTTGTCTTTGTTGATCGTCATGATCTTCGGCACGTGCATCAGGATCTCCAGATGTTGTTCTTTTTCCGCCTTCACATTGGCATCAGG
CACGTTGCCATGCTTGGCGGGAACGCCCCCAAGTCGCAGCGAGTGCAAGGATCACGTTCACCGTCGTCACGTCCATGACGGCGGCTAACGTAAGCGCGTA
GTCCACTCCAAACACTTGCTCATTGACGCACGCCACTAAACGCGCCTTGTGCCGCTACAACTCGCCTTCAGCAGTCGTTTTGGTTTTGGAGACCCACTTG
CTGTGGAGCACGTTGCTGTGGCACGAGCATCGCGCCAAAGTCCACACGTCGTTTGCTTCGAGAGCGCTGATTTCCTCGGGCATCGCGACCTGCCACTCTT
TGCACTTGACGCTCTTCACAACCTCCGAGTAGTTCCGTGGGTCTCGCTCGAACACATGACCAACGACATCGACATTGCTCGCTGCTTCGTCTTGGCTTGA
TGACGACTTCTTTGCAGATCCGCGTGTCATGTGTGGCTCCGTGTGCTCATTCTCTTTTTGGACTTCTGCTGCTTTGTCTGCGCTGGCGCGCCGTCGTCAG
CGTCCGCGCGATCTTCTTCATCGAGCTCAAGATGCAGCTGTCGGTTTTGCACCTTGGTCAGCGTCTCGATGTTCTTCACATTTTGTGTCGTGACGACTTT
GTTGTCTTTCTCTAATAGACCCTGACGCCTTTTGTCTCGTTGCTGCACCCGAGGATAGTACCGACTTGAGCTCGGTGCGCAAAGTTGTTCTTCGATGGAT
TGAGGTAGACAGTGCATTATGACTCAAAAACGACGATGTTGCGCAAATCGGGCGCATGGCCGTTGAGTACTTCCAGTGGCGAGGCTCACTTCGGATTCGA
GTTCGTGGGACTCCGGTTGAGAATGTAGGTAGAATACTCCGCCGCATCTCCCTAAAACGTGAGTGGTAGCCCTGAAGCGAAGATCATCGCTCTGGTCATG
TTGAGGATTGTACGATGCATCCTCCCATCCTTGCCGTTGAAGGCCTGGTTCTTGGCCTCGCTCAATTGTCTCGCAACACCTGTGGTCTTGCAGAAACGAT
CCACGCTCTCGTACTCCCCTCCACGGTCGGTCCTGAGGACGGCGATGCGAAAATCGAACTGCCTTTTAAAGAATTACAGGAAGTTCTCGAACTTCTTCGT
AGCAGCATCCTTCGTGCGCGTCAAGAACACCCGACAATGATCGCTCTCATAATCAATAAAATTGATCAAATACTGATTCTGAAGCTGATCGGCTGGCGTC
AGAGGACCTTTGAGGTCTGAACAAACGACGCCTCCAATGCGATCAATCTGAGCGTTCTGGTCCGAGTCCTTCTGGCTCTGCTTGTTCTTTGTATGCTTGC
TCTGGTCACAAGTAATGCACGTCATGCGCTTGTGGCCCGTGAGTTCGATGTCCGACATCGGGTTCCTGTCAATCTTCTCAATCGTGTCAAGCGAGAGATG
CCCCAAGCGTTAATGGAAGTGGAGCAGCGAGCCGTGATGCATTTCGGGGACGTTTCAGCCGCTAGCTCCTCCTGTGGAGCAGCCATGATGACGTCAACTG
GCTCTTTCATCCTCGCGGCCATGCCACTGTCTTGACGACCAAAACGCTGTTCTGTAACACAACGTCAAACACGACATGATCGTCACTGCGGCGCGCAACA
ACACGCTTTCCCCTCGCGTACGTCAACGCGTAACCATTCGCGTTGAGATTCTCGTAACTCACTATGTTGCGCGCGAGACTCGGCGCGAAGTACACGTTCG
TAAGTAGCACATTGCTCTCCTTGCCGTCGGCGTTCACAAAGAGCCGTACGTCGCCGACCTTCGTCAGCACTAGCTTCTCATCGTCGGCAAGTGACACCTC
ATCGCAGCATTCTTTTGCGTGTAGCACCAGTCGTTCATCATTGAAGAGGTGGCGGCTTTGCCGCTGTACAGGATCCAGTCTTTCCTGGCGTCGCCGTTGC
CGTCTTGCACCATGAGGATGACCTCATCTTCGCTGTTACACTCGTAGTGCTCTTCCTTTGTCTTCTTCTTCGAGTTGCAATAGATCTTCAAGTGTCCTTT
CTTCCCGCAGGTGTAGCACGAGCGATTCTCCTTCTGCGTGTCGCTGTCTGTGACTGCCGCAACGACTTCGCGGTCGATTGTTCGCCCGGTCTTGTTTTCG
ATCTCAATTGCTTGGGAAAAGTGTGCCAGCTCCTCCGCTTGCCGTAAGTGGTCGTACCTCCCGTTGTTGTACTTTGCCATCAAACACGGTACTAAGCTCC
CCTTGACGCGTAGTGGACAAAGTTGCCCAGTACTTCTGCCTCGGCGCCTCCACCTCACGCGTCGCATACGGTGACGAGGCACAAAAAATGCTCCGGCCAC
GACCTCTTTGTGTCCTTCCTAGCCGTGAAGAGCTTCATGCTCTGCGACGCTGTAATCGTAGTCCTAAACGTGTGCAGCATTCGACCCATCGCGTGGTCAA
GCGTCGCATCTTCGAGCCACCAGGTGTCAACTTGTTTTTGATAATAGCGTTCGGTCGTGCCTGCCAGATAGTGTCCCAGTAGATTGACTTTGACATCTTC
CGCCCATGCGAATCCACACGCTTGTTCGACCATCGACACCTGCCAAAGTAACGTTCTTCTACAGTCCAAAAAGCCAGAATAGAGGCCCTGGTAGAGATCA
CTGCCGTCAAACTTTCGAATCGCGAGCTTTCGTTGGCGCGCGTCCGGTGTACG