Description :
From Genome Similarity Track
Location :
Scaffold_949:3414- 5490
Transcript NameFunction/comments
Phypl_g11783conserved hypothetical protein

Sequence
2076 bases(100 bases per row)
CACATCGATCGAGTTGGGCGTCGAAAACAATGCCGACTCGAATGAGAAGCGTGAGGAGCTTGTGATCAGCGGTGGGTATGAGCGCAGTGGCGCCATCTCG
GTGCTACACAACGGATTGCGCCCTATCGTTGGCACCGAGGCTGAGCTGAACGGTTGTCGAGCAATGTGGACGGTATCATCTTCACTGCCTTCTGCGACAA
AGAGCTCGGATGGCCGGAGTTACAACGCGTACCTGATCTTGAGCGTTGCTCAGAGAACAATGGTGCTGCGAACTGGCGAAGGTATGGAGCCCTTAGAAGA
TGACAGTGGTTTCTACACGTCCGGTCCTAcccttgctgcagcaaattTGTTCAACAAGCAGCGAATTGTTCAAATATTTAAGCAAGGCGCACGGGTGATG
ATGGAAGTACCCGAAGAGGAAGCACCAAATGGGCAGGAGAAGGCAGAAAAGGCCGAGGGtgctgaagaggaagacgatgacgacaaAGATGACGGCCCAA
AGGTCAAGCTGGTTTGCACGCAGGAGATCACTCTGGAAGGTGACGTCGAGTGTGGAGGTATGAATGTTGACACTGCAAGCGTAGGAATCGTGTCGGTGGA
TGTTGTTGACCCGTACATTCTTCTGCTTCTGACCGACGGCTCGGTTCGTCTGCTGATgggagacgaagaagacatgGAGCTGACTGTGATCGACCCGGAG
ATCGACTATCTTGACGGCATCACTGACTCGAATGGAAGCGCAGATGCGTCCAAGCATGGCAGCAGTTCTGCTTGCCTCTTCTACGATTGGGCTGATATGT
TCCGTGAAAACGCATGGGgggaggacgagcgcgaagAGCGTCGTGAATATGCTGCAACAGAGAGCAAAAAGGAAAGCGCccgtgacgatgacgatgacaT
GGACGCATTGTACAGCGCTAGTAAACCAAGTCCAAAGGCGGCCACGGCTATCCGCAGTAGCGCGGCGAAGTTGGTGCCGGCCCTAGCTGCACAGAAGAAT
GCTGACGGATCTGTATCGATTCCGCTGCTAAAGCAAAAGGATGCCAAGATGATGTGTGGCATGTGCTTCGGAGATGGTTCTCTTCATGTGTTCTCCCTCC
CTGAGTTCAAGAAGAGAGGCGTGTTCCCGTATCTCACTTTTGCGCCGCAGTCGCTAGTGAATACGCTCGAGCACTACCAGGTCAGCAAGAACAAAACGGT
GAAATTCTCTGCCCCCGTTCTCGGTCTCAACGCATCGACATCTTCAGCGAACGATGGTCGTATCAAGAAGTCGCATACGATTAATTCGCCGGTGGCAGAC
ATCGTCATTCACCGCGTCGGTCCTAGCGAAGGGCAACACAACGCCCAATACCTCTCACGGatggtgatgctggtgttCCTAGCCAACGGCGACTTGCTCA
TGTATTCAGCGACACCGAAGTTCGAGAGTTTGAAGCCCAGAGCCAACGGGGAAATCGCGCCCGTGTTCCATTTCGTTCGCGTGGGGACCGATCTGATCAC
GCGACCATTCCTGCCCCCGAAAGCACGCACAAGTTCTCACAATGAGGCTGGTAGTAACCCGGAGGTTAACACTAGCGCCGTGTTGGCCAAGCTCCGTGCT
GGCTTCCGTTACCCTATGCTGACATTCTTCTACAACGTCAACAACATGAGTGGCGCGTTTTTCCGAGGTGCGCACCCAATGTGGATTTTGGGTGATCGTG
GACAGCCGTCTTTTATCCCGATGTGCGTCCCTGGCTCCGCTCCGCCTGCTCCAAAGGCAAATGGTACTTCCAACAGAAACGCTACTCCGCGGGTGAGCGT
GCCAGTATTGAGTTTCACGCCGTTTCACCACTGGAACTGCCCGAATGGATTTATTTACTTCCACTCACGCGGTGCGTTGCGCGTGTGCGAACTTCCTTCA
AGCAAGACGTCAACAATTCTGCCATCAAGCGGTGGTTTTGTGCTTCAGAAGGCCGAATTCGGCGTAACCTTGCACCATATGCTCTACCTGGGCAACCACG
GCCCCGGGGGTGTTGCAGAGGCGCTTGAAGCGCCCACCTACGCTGTCGTTTGCAGTGTGAAAATGAAGCCTGCTGA