Description :
From Genome Similarity Track
Location :
scaffold_35:34139- 38167
Transcript NameFunction/comments
Pl_111553hypothetical protein PHYSODRAFT_564300

Sequence
4028 bases(100 bases per row)
CCACAACATTGCGTTCCTGGCCGCCATGTGGGCGCCCGTGGTCCTCGTGTACATTTACGACTCGCAGATTTGGTTGGCCATCGCACAGGCTATTGTGGGT
GCCTGGATTGGTTTCCGCCTTAAGATTGGCCACTCAGCTCGCATTAAAGAGTTTGTGATGCGGCTTCAGCAGGCACCTAACCTTTTCGACGAAAAAGTGG
TATCTGCTGCCGCCCGTGGCCAGCTGGCAATCAACAACAATCCTCTGTCATCGAGCTCTGTTGCCCCGGATGCCAATAGCCGTCTGCGTTTTGCGGTCGT
ATGGAATGAAATCGTGAGTAGTTTCCGCTTGTCTGATTTACTGGACGACCGTGAGACTGCTATCCTTCAATATCAAATCTCGGACACTGGTGCCGTCGAA
GAGCCCGTGTTCCTGATCGCTGGTGAGGCGCAAGCGGCGGCAGACATTGCTGCTAAGGCCAAGACTAAACGCATGAGCGATGGTCAATTGTTCAAGGAAC
TGAAGAAGGCGGGAGTGCTAGGTTGCGCCAACAATTGCGTCGATATCATGTTCCAGATCCTTCGACAGCTTTTGGGCCCTCAAGACTCGGAGCTAGTTGG
TGTATTTCACCAGATCCTAGCAGGAGGTAAGGTGAGCGGTATTGTGAACCTCACTCACGTTGGATTGGTGCGCGAGAATGTGGTTGACTTGCTTGCGAGT
ATCTTGGATCTTCCGGAGCCGACTGTGGGGCCTACAGGTACTGCCTTTGGTTTCCCACATGATCAGGTTTTGGTTGTCGTGCAGCGTGTGGACGCACTGT
TGAAGAGTATTGAACTCATGCTGGAGGAGGAATGGATGGCGGAGAAGCTGCGCAAGTCAGCGTTCGCCAAGATGACGCCTGACCTTGCCTATCAGAAAGA
GCAGTTGTTATCGATTTTTGCTGACCGCATCAGCCAGCGCGACTCAAACTCGCCTACGCGTACAACCTCGCCGAGCTCGAATGAGAGTGTGGTGTCTCTT
TCGACACGATTGTTCTTCTTGCTGACCCTAGATGCTGCTGATGCGTTGCCTCGATGCCACGAAGCTCAGCGCCGCATGAGTTTCTTCCTGAACTCTCTGC
ACATGAAGATCCCGACTATTGACTCCATTGCAGCGATGAAGTCGTTCTCTGTGGTCACGCCATACTACAATGAAACAGTTTTGTTCTCAGTTGATGAGTT
GAACGGACGTGTGGATTCGAACCCACTTTTCCGCAAGGTGGAGCAAAAGGGCCGTGATCTCAGCATTTTGAAGTACCTGATTACTTTCCACGACGACGAA
TGGGGCAACTTCCTTGAGCGTGTAGGTGTGGCCTCTATGGACGAGGCTCTTGCTGAAACACCTACGCAGGTTCGTCTCTGGGCGTCTATGCGTGGACAGA
CCTTGGCGCGCACGGTGCATGGTATGATGATGTATGAAGACGCCCTGAAGATGCTGCGCTGGCTGGAGATCGGGTCGGACGAGAACATCTCTCATTTGGA
GAAGATCAAACACATGGATCGCATCGCAGGTTTGAAGTTTTCGTATGTAACCAGTTGTCAGATTTATGCCGATCAGCTTGCGGCAGGAGATTCACGTGCT
GCTGATATCGACTTGCTTATGCGCAAGTACCCGAACTGGCGTGTGAGTTATGTTGACACAATTCGTCCCCCCGCCGGAAGTGGCTCAGAACCTCGTTTCG
ACTGTGTACTTGTCAAGTCGGACGGTGATGAAATCGTTGAAGTATATCGTTACGAGCTACCTGGAAACCCGCTCGTTGGTGAGGGTAAGCCTGAGAACCA
GAACATTGCATTGCCTTTTACTCGTGGTGAATATGTACAGACAATCGATATGAACCAAGAACACTACTTCGAAGAAGCGCTTAAGATCCCAAATTTCTTG
GCCACTGCTACGCAAAATGGAAAGAACGTTACCATCATCGGTATGAAGGAGCACATTTTCACGGGTCGAGCATCATCTTTGGCGCACTTCATGACGTTGC
AAGAGTTGGTGTTCGTGAGTTTGACTCAGCGTGTGCTGGCAAACCCACTTCAGAGTCGTATGCACTATGGTCACCCCGATGTGTTCGAGAAGTCATTCAT
CATGTCGAATGGTGGTGTGTCGAAAGCTAGCAAGGGCATCAATTTGTCCGAAGATGTGTTCGCTGGCTACAATGTGGCACTTCGTGGTGAGAAGGTAACT
CACGAGGAATTCATGCAGTGTGGCAAGGGTCGTGATGTGACCTTGAGCCAAATTAACGCTTTCGAGGCTAAGCTGTCAAACGGTAGTGCTGAAAGTTCGC
TGAGTCGTGAGTCGCACCGAATGGGCGCTGGTATGGACTTTTTCCGCTTGAACTCGATGTTCTACGGCCACATGGGCTTTTACATCTGTAACGCATTGGT
GGTATTGTGTGTATTCGCCTACGCTTATGGCAAAGTTTACATCGTGTTGCACCAGGAGATTGAAGAATCTGCCATCATCACCACGAACTACTTGGATGAT
CTTGCTGAAGTGATGAACACCCAGTTTATCTTCCAGTTTGGTATGCTGATGACTATTCCTCTGATTGCTACACTATTTGTGGAGTACGGTTGGCACCAGG
CTGTGGTCAACTTTGTGGAGCTGATCGTGACTCTTGGTCCGGTGTTTTACATCTTTGAGACAGGCACAAAATCACACTTCTACGATATTGCCATCATGCG
TGGTGGTTCTAAGTACCGCGGTACGGGTCGTGGTTTTGCCATCGTTCGTGAAACTATGGTGAACTTCTACAAGGAGTACGCTGCTTCACACTACCGGAAG
GCTGTGGAGCTGATGGGCTTGATGATTATCTTTGGCACATACGGTAATTTCAACATTGGTACGAATGTGTTGGCTGAGTACTGTGCCACTGCAGACTTCG
ACTGCGACAAAGATCCCGACCAGATCCCATCGAACATCACGCTCTTGAACTCGTACAGCTCGAAGGGACAAGACTATGGCATTGCTTCGTTTGCTGTATG
GTTGCTCGGCACGTGTTGGCTGCTTGCACCGTTCCTGTTCAATACTGATGGCCTGGATTTTTCCAAGACCCGAGTGGATATCACCTACTGGTTCACATGG
CTCATGTCAGTTAAAGAGGCAGATAATGACGAAAGGCTATTACCGAATCATATGAGCAGCCATCCTTCAGGTCCGGCTGACACATGGAACGATTTCTACA
ACTATGAGGCAAGTCTCATGCACCCTATTGGTCCGATGAGCCGCTTCGTGTACGCGGTCCGTGAATTTCGTCACCCACTAGTCATGTACTATGTCTTCAT
CTACTCGTTCAGCCTGAGCGATATTGGAATGCTGTTAGCGTGCGTTGGTGGAATTGCTGTTCTGTTGTGGATTGGTGGTTTTGGCTTGGGAATGTGCTTA
CGCAACAAGGCACGTGTTCCGCGCGCCATACTCTATGTCCTGATGGTTGTGGTCATTGGCATTGCGCCATTCGTGGTGGGCTCTATGCAGGACTGGGATG
GGATTAAGTCTTTCTCGCTGACGGTGTCCTTATTCACTGGATTATTCTCTCTCTTGCACTATCTGCAGTTGTTGCACGGATTATTTGGTTTGCCAGTTGC
CAAGTGGGGTCTTGTGCGTGAACTTGCCTTTTTCTTTGACGTGGTTGTGGGCCTGTTCTTAGCGCTCCCACTGATGATGCTGTCGGCTTTCCCGTTCATG
AAGACCATCCAGACTCGTATGATGTACAACGGCGGCTTCTCACGTGCGCTGAGCTCTGGCAGTGAGTTCGCAGCTTCGCTGAGCGTGGTTGTGGGTGGTT
TGGGTGGCTTCACTTACGGTTGGTTGACATGCCTCATCTTCTCTCTGGGATATGTGAACTCTTCATCCGATAACTTTGTGAATGAGTCATTCATCTACTT
CAACAATGAGACCCTAGATGGTGCATTAGATCTGACCATGATCAAGGTATACGCCGCTGGGGCTGCTGCTGTGGGAGTCATCATGAGTGGTGGCTTAGCT
CACGTAATTGGCCGCCGCTGGACAATTG