Description :
From Genome Similarity Track
Location :
Scaffold_89:34133- 37356
Transcript NameFunction/comments
Pytve_DAOMBR484snap-pve_contig_89-abinit-gene-0.104Dual specificity mitogen-activated protein kinase kinase
Pytve_DAOMBR484snap_masked-pve_contig_89-abinit-gene-0.76Gene of unknown function

Sequence
3223 bases(100 bases per row)
CTTCTTCCGCCGACTGCCGAGCCGAGCCATGCCGTCGTGCAGCTTGCGCCAGAACGACCCGCGCTCGCCACCCGCCGGGCGGACAGGACTCACGTCCCCG
CTGCCAAATAATTGCTGCCGGCGGTTGATGCCAGGAGAGGCTGTCCAGCTCTGCGGCGAGTAGCAGTACTCTTCCAGCAGCTTGTCGCTGTAGAAGCATC
GCTTCTGCATGATTGCAAACGGAGCACAGCAATCCAATGTTCAGTGAGCGGTTGCATCCATGGAGAATCAACAGGGTCGCATACTTCTTCAAATTTTTCG
TAGACGTCGTGCACTGGAAGTCCCAGAAAACTTGCCAACCCGAGTTGCAAACTAGACAAACCCACCACACTTTCAGTGAGTTTCGAATCGAGTGGCCATC
CGTACCAGTCGAAACGCACCTCATTTGAATTGGCTCGATGGAAATGACGCGTCGAGAGTACGTAGGTGTAGCTTGTGACATAAACGACATCCCAAAGTCC
GACTGCAGCAACATGTCAGCGAACTCGACAGCATTTCAACACAAATCATGACACTGTCGAACCTGTGGCTGATACGAAAACTTGGCGATGCGCTCGTACA
AGTGCCGATACGCAGCGTCGGCAAACGCGTCCAAGTCAGTTTCGCGGTCATCGCACAAGTGCTTCTCATCGACGAAGTGGAGCCACTGTACATCCATCCC
GATCAATGTTACTGCATGGTCTCGGACAAGAAGCAGCAGAACATCAAATACCTCGCTTAGCGTTTCCTCAGCAGTGTACTTGTGTAGGAACGGGTGATGC
AGCAGCTCATCAGCAGAGGGTCGATCATCCGGCTCGATTGCCAAGCACTGAGGACAGCAACAGTGTATGTTAGAACTCATAAACGTGGCACAGCGGTCGC
CAGTAAGATCGCAACGCAAGCCTCACCGCTTCCACGAACGATCGACATTCATCAGAAAACTGATCGGGAGGCAGCTTCAGACTTTCTTCGTTGGCGACCT
ACACGAACGCAAAAGCATAATCAGTAAAGTGAGTGCTGATACAAATCAATGGAAAGCACAGCGCAACCTACCGAGTCCACTAAACCGAAGAACCCATCTT
GCGTCGGAAGCGGGTAGCGACCGAGGGCAACCGAGAGCAGCGCGAGTCCACACGACCAAATATCCGCTGCGACACCGATTCAAAACGTCACATCTTTCAT
ACTCGCAGCCAAATGATATCAACCCCACGCACCTGAATACGAATAATCGCCACCGCCAATTCGCTCCGGTGCCATATACAACAAGGTTCCCACAAACGTC
TTGGTGCTGCTCAAGTTATCGTTGAGCGTTCGCGCCAAGCCAAAGTCGGAGATCTTCACTTCGCCTTGTCGATTGGTCAGCAGGTTGTGGGGTTTGATGT
CTCGGTGAATCATGTGCTTTCGGTGGATGTGTGCCAACCCGCGGAGAACACCCGACGCCAGTCGAGCGAGAATCTTCTCGTTCTGGCAGCCCCCGCGCAC
AACAATATCTTGGAGCGACCCTGTGCTCATGTATTCCATCACCAGGCATATGCAGTTCTTGGGACGGTCAACGAACGCGTCGTAGAAGTACACAATGTAC
GGGCTTGGACTGCAATTCAGCGACAGAACACCGTTAGAACAACGCCACCCATGCAGGCAGGAGCAAGTTTGCGCACGTTGGCTTTGCCGTGCTTTTTCGG
GGAGCGTCGACAGACTGGGGACTTTCTGTGTCCGACATGGGAACCAGATTCGAGTAGAGCGCGTGAAGCTCTCGAACCATTTGCCGGCGCTGGCCTCTTC
CGTAGACTGGAACGTCCTGTGTCAATCAGACAATTAAGTAACAGGTTAGTGATACACAAACCGTCTGCGATTGCAAATGCGTCAAAACACACCTTGACGG
CTACAACTTTCAGCGTGGGGATATGAATACCCTTGTAGACCACACCGGATGCACCACGCCCAACCTCCTTCACTCGTTCCAGATTCTCTTGCAAGTGAAG
GCAGGCAGCGTCAGGCGACGAAATCCCTGCCTCGGACACGGCGACACTTTTTGTCGTGAACATCCCGTGGTTTGGAGAGTACGCGCTGCCTCCGCTATGA
CGGCCAGCCTCTGTACACACATATCAGTGTGAGTGAACTTGTGTCCAGTAAGACTCAATAACCCGACAGTCGGAACTTACCGCTCGGTGAAGGAAGGTCA
GAGTCGCTACTGGAGCTGTTGTAGGACTGGAAGCTAAGCTTCATGTGCGCCACCTGCGCAGCCGAAGGACCTCCTCCATTATGTGCCGACGTTCCTGCCG
CAGAGGCCGCTGCTGCTGCGATCTCCATGGCCTCTCGTTTCGCGATCAGACGGTTTGCAGCTCGCTGTGCTCGCTCTTCAGCTTGTTGGGGAGTAGGCAT
ATCTTCTAACTTCAACCGCAATTGAGGTCGCTTGGAAGACCCCGCTTTGCCCAATGGAGCGGGGAGAGGCGAGAAATGTGGAGGGTTGCGCGGAGTCAAG
GCGTCTGTTCGAGGCGTGAACGCACCTTCCATCTCGAACTGGGCCGCCGCCATCGGATGCTCCGCCTNNNNNNNNNNNNNNNNNNNNNNNGCGAAAGTTC
TTCGACGACGCTGTCGATCGCGGAATCCAGCTCGCCTTCTGTATCTCGGCTCGTGTTCCTGGGACTAAACGACCGGCGCGAGTTCTCGAACCTCCGAGCA
AGCGATAGTTTCGGCGACGACGCTGACGAGAACGCTATGCCCGGCTGCATCTCGTAGTAGTTGTCGTGCATCGGTTGGTGAGCGTCATGAGTTGCGAAGA
TCATCTCAGGATCCTCCTCCTCATCAACGGGGAACTCGCGATCCATCCAGTCGCACTGCCAGGACCTCACCTCGGCGATGCGCAGGTCGCGCGGCCGAAT
ATCCGGGAAGATGTTCATAATGGTCGGGTCATCTGCCTGTAAGTTCGCATAGGTTAGCCGTGCCGCATAGAAACTGGCGAAGAACGACGACGCATTGTCT
CACCTCGGCAATCAGTTCGGGGGCCGAGTACGACCGCAGCCGCAGACCGTACTTGCGCGCCATCCGCTCCAGCTGGTTCGGCTGGTTGTGGTGAGGGGTG
GCGCGAGTCGCGCGGAAGCTCAGGTAGTGGCCCGTGGTCGCTCCGCGCAGGCGGGCGGCGGCGTTGTGGTGGTCGAAGTTGGCGCTCTCGACACGCCCGC
GCTTGCGGAGCCGGTCGCCGAGC