Description :
From Genome Similarity Track
Location :
scaffold_1192:3413- 6007
Transcript NameFunction/comments
g11142.t1hypothetical protein

Sequence
2594 bases(100 bases per row)
TTCCGATTGGGCGAGTGATGACTTGGCGAGCGAGACGAATCGTGGGTTGGATCAGGCGCAGTCGAAGGACGTTGAGAGGGGTCAGGAGCAGCTGAGCGCT
CAGAGAGCTCAACTGTGCTTGTGCAGCCTTCCGTTCAGCGATGAGGCGATCGCGCTCCGTTTCCACCACGGCCCGTTCTTGGAAGGCGTTGTCGCGCGCA
TCCTCTACAGTGATCCGGGCCTGATGCTACACGTCAAGATCCGAAACCAGATGTCGGGCGAGCAAACTAGCTTCCAGCGTGTTCTCGGCCGCAGTCTGGA
GATGCGTGATGAACTCCAAGAAAAGCTGGACAGAGTCACGAGCGATCTCCAGAGCAAGCAGACGTCATTAACCAAGGCATTACAGACTCAAGTCTGCACT
AAACAGGATCTGGATGCGAGTCGTAAGTACCGGTCCCTTGTCATACGTTGACTCACTCGTGACATATGCTGGTGGGACGGTTTTGTACTAGGAACCCAGG
TAGACGTCCAGCGTACACGTATCGCCGATCTCGAGCGCCAGGTCGGTGGCTCTCGCCAACACGAGCTGGAGGCTCAGAGGTTCAGCGCCAAGAAGATCGC
TCTGACGAAGGAGGTCGGAGATCTGCCTGTTCAGTGAGGTAACCTGCTGCTGGAGGGGCTGCGCCGTGTTCACTGCTGTCTGTTCAGACACCGTCCGCCG
GTGAAGATCGTCCTGTACCCTGTCGCGCTCGGCTCGGGCATCATCACGCTCAGCCGCGGCAGCATCTCGATCATCCAAGGCGGCATTGCGTGCAGTATTA
ACAGCATCGCGTTCTCCGAAGCCGGTATCGCGCTCAACCTTGACAGCCTCGCAGCATCGCGTTCTCCCAAAGCAGCATCACATGTGATCTTCACGGCATC
ACGCTCAACCTTGGCAGCATCACGTTCTCCCAACGCAGCATCGCGTGTGATCTTCGCGGCATCCCGTTCGGTTATGGCGGCATCACAGTCCGCAATCGCT
TGTACAAGTTGGACGGCGTGGGCAGGAGGGCCAGATTTAGCGACGCGGGCTTCTAGTTCGTCCATCCGTCTTTGGAAGCCCGATCCAACATCCTCATGTA
TGCGTTGATGTGCCTGGAGCCGGTCTCACAGACACGCGATCTCCAGAGAATTGTCACGACGATCGGCTAATGCGGACTCCGTCTCGGCAAGCCTAAGCTG
GGTGTTGTCCAGATGAATCTTAAGGATATTGTACCTGCGCTGACAAATTTGACGAATGGAGCCGCCTGCCTCTCAGCCTGAATCAATGCAGTCCGCACGG
ACGTGATTTCATTGCGCAAGGCCGCATGTGTGCGCTGGAGAACTTGGTGATCCTCCTGGCGATCACGGTATGCCTCCGTCTGGAGCCGGTATGCCTCGAG
CTGCCACCGAATGTTCTGGAGGTCCACAATGGATGACTGCAGCGAGTGTTCATCGATATCCACGAAACCTAAAGCTAAGGTGGGAAGTGCAGGAGCCTCA
AGTCGACGGATACCACTTACAGGAGGTGCCGTGATCTTCGTGGCATGGGGAACATCGCCGCCGGGGTTCTCTACATCATACACGGGTGAATACAGCATCC
AAAGCGAAGGGTAGCGGTTGAGCACCTACGTGAGGCAGATGCGCGATCATCAGGGTTGAGATGAGCGCCTGGAACAGTTGGAGACTCGCCAGACACTGCT
CAGGGGCAGACAAGTACAAGAGTGAGGAGGCCGGCGATTACATACTGGTGATGAAGAACACGTACTTGCGGCGGCAGTAGGAGTCTCTGGAGGGCCGTCA
CGAGCGACGGGGCCGCCTGAATCCTCGGCAGAAGCTATTTGATGTCAGGAAGAGACAACAGTGGAGTCAGAACCGATGGACACGAGTCAGAGTGGAAGAA
CGCGTACCTGCGATGGACTCAGTAACAGCTGGAGCTCCCATAGGATCGTCAGACGCGCCAGGGTCATCCGAGGAATGAGGGGACGCCATGAGAAACTCGA
TGTCCGCGCCAGAGGAAGCTATGTGGCTACGCACGGGTCCCGATCGCTGTACGAGCTGGCCTCCGCGCGGAGGACGATTGTCGTGGAGCGGGAATCTTGT
TCTGTGAGAAAGACGGATCTCCAGGCAAGGGTACCACTTTTGTGGTAAACCGTCAGGAAGATCATGGTACCAAGTTTTAGGTACCGTGTCGGGAAGATCA
AGGTGCTGGGAATATCAAGGTGCAATTATTTCGATACACGCCAGGAAGATCATAATGTTCCAGAAGGATGGTACAATTTGTACTAAGTCCGATCTTGTAG
CCAGTTCGTAAAGGTAAGGCTGGGAGCCGTTCGAGGTTTGAAGTACCGTGGAGAAAGGGTTAGAAAGGTTATAAAACGGTGTGTTATTTACCCTCACGAG
AGAAGAAGAGTAGCTTAAGCACTCAACAACCGAGAGAGAGAGCTTTCCCTTACAAGACACAAGCGTCCTACCACATTCCAGAGCTGGGAAGTACATTGGT
CCCCTCTGACGACCAAGGATTGCTACAGTCTACAAGGGAATAGCGCAAGAACGCCTGGGTAGCTTGCCCAGATCGCCCCGCTCTCTCTCTCCCC