Description :
From Genome Similarity Track
Location :
Scaffold_410:3413- 4637
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_410-fgenesh-gene-0.4Hypothetical leucine rich repeat protein

Sequence
1224 bases(100 bases per row)
AGTATATTCATCAGTTAGATGGCAGGGTTGCGGTGGATGTATGGCAAGTTGCTGGGCAGCGACTTGATCTGCAAGCGCGCGCCCTGCTCTTCGTCAATAG
TCACGACGCGCGGGTTCACGACCGACGCGTCGTCGCCCAGCAGCTTGGCTTCGACGCGTTTCGTCAGCGCCGCGACCGAGCGCACCGAGTGCACGGATCG
AATGGACTTGCACTCGGAGAGCACTGTGGACGCGACGCTGCGGGCGTCGTCGTCGTCGCCGTCGCCGTCGCTCTCCGTGTTGCGCTTCCACCGGAGCAGA
TCGTTGCCGGTGAGTGGTCCACTGCTCCTGTCTTCCTGCCGCTGCTGCTCGCGCTCGACTCGCTTCTCTTCGGCTTCCTCGTACTCGACAATGCTCTGCA
ATTGTGCCATTTGCTGCTCTACTTGCGCCACACGAGCCTTGATCTCCACGTCGTCCATGAACTGGTCCAAGTCGAGATTGTTAGCAAAATCGATGAGCTC
ATCGGCCTCGTCGTCCTCCATTTGCTCGAGCTTCTCGTCCGCTGTCTCCTTTGTGAGAGCCCACATCGGCCGGTTCCTGAGCTTGCGGACCTTAGACGCC
GCCTTGGGGTGGTCCGTGTCGCCATCTTCAGGCTCGTTGCTTCGAACTGCTTCACGGAACTTGGCTTCTCGCTGCGAGAACCTGCCACGGCGAACGTGTG
AACGCCTGTATTTTTGTTTCGCCTGACCGACAAGACAaCGCACCGCTCTCGCCTCTGCTGCTGCTTCTCTTCGTCCGCTTCCAGCTCTTCCTGCAGTCGT
GCACGCTCCTTTTGCAGGTCATGAAGCCACTTCTTGTGCTTGGACAGTGCCGTGTTCTTCTTGTCGCGCTTGACGGCGTGCTACAAGTGTCAGGCAGGTG
CATGGCGTGCTGTCAGCGTGCATGAAGCGTCATGTGAGGTAGGTCCCATGGCGAACACTCACGGGGGACTCGCTGTGGATGGGCACGTTCATGCCCAATG
GCTCGGCTGGGATGCCTGCGAGGAACGCGGCTTTGGtCGACGAGCTCGCAATGTTGTCACTACTCCGCGACTCCTTCGCCAGTGCTAGTGAGACCACACA
TGAGCATCGGTTTGAGCACAAGGCCACTAGAACACTTCCACGCACTCGTGCTGACGCCGTTGAAAGGCCGGTTACAGAGCATCACGCCCTTGTAGTTGCC
AATGCTCACAGCCGCGGCTGCCAT