Description :
From Genome Similarity Track
Location :
Scaffold_35:3413- 4498
Transcript NameFunction/comments
Phypl_g1375DEAD/DEAH box RNA helicase, putative

Sequence
1085 bases(100 bases per row)
CCGACGCCCGTCCAGGCGCACTGCATCCCGCCCATCCTCGCTGGACGCGACGTCATCGGCTGCGCGCAgaccggcagcggcaagacggcGGCCTTCGCGC
TGCCCATCCTGCACACTCTGAGCAAGGACCCGTACGGCCCgtacgcgctggtgctcacgcCCACGAGAGAGCTGGCCTTCCAGATCGCAGACCAGTTCAA
CGCCTtcggcagcgccatggccgtgCGCTGCGCCGTCATCGTGGGCGGCGTCGACATGCTCAAGCAgtcgctgacgctgcagcagcgcccgcaCGTGATC
GTGGCCACGCCCGGCCGGTTCCGCGAtcacctgctgcgcgtggaccCGCCCAACATCTCGCTGGTCAAgtacgtggtgctggacgaggccgaccGACTGC
TGGACGTATCCTTCGCCAAGGACCtgagcttcatcttcgacaGGCTGCCGATCAAGCGGCAgacgctgctcttctccgcgacgatgacggcgaACTTGGA
CAGGCTGGAGCACACGGcgctctcggacgacgcgTTCCGCTTCGATGCGACGCCCAGCgtgaagacggtggcgacgctCAAACAGTTTTATTTATTCATC
CCGGCGCAGGTCAAGATGACGTACCTCATGTACttgatgaagacgctggaccCGACCGAGGAggatgaggaggaagagcggAGCGGccgcaagggcaaga
aggaTCGggacctgcagcagctgctggaggccgccgcctcgacgtCCAAGCGGCAAGTGCGCTCCATGATGATCTTCCTATCCACGTGCAAAATGTGCGA
GCTGGTGGGCGAGATCGGCAACGAGCTGGGCACCAAATGCGTGACGCTGCATTCGATGATGTCGCAGAACCGGCGGCTGGCCGCGCTGGGCAAGTTCAAG
AGCGGACTGAGCCACATCATCATCAGCACGGACGTCGCGAGTCGTGGTCTGGACATCCCGGAGGTGGACGTCGTACTCAACTTCGACCTGCCGCGGGACG
CCGACGATTACATCCACCGCGTGGGTCGTACGGCCCGTGCCGGCCGCAGCGGCCAGGCCATCTCTCTGGTGACACAGCAcgacat