Description :
From Genome Similarity Track
Location :
Scaffold_290:3412- 7032
Sequence
3620 bases(100 bases per row)
GATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACAGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAGACCG
GCCGACTTAAACAGCCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTGAGATCCAACACGAGCAGGAGCG
CGAGTATCTCCTTCTCCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGCGTCCGGCTAACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTAC
CAAAGCTGCTGAGACCGCCCAGTCACTGGAATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTC
CTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTT
GGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTG
GATTTTTATCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTAATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGAC
TGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAG
CCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCC
AGTAGGGATGTCACTCTTTCGCACAACTGATCCCGCGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAG
GATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGCGAGC
GTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGTATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATC
GCGCGAGCTCGATCCGTCATAGTAACTACCCAAAACCCGCTGGCCATGTCAAGAGAGCGGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGA
TTAGAGGCACCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTAC
CACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACC
TTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCA
GATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCTTCTGT
GGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGCTCATCTTCCGTCTTC
GTAGGGTCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGATACCCTGGGTATCAGGGAAACCACCA
GTTGGATCTAGTCGGTCCTCTAACGAGCTTAAACCCGACGGTTCTGGTTTGACTAGTGTTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGA
AAGCTTGGATCCAGTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCT
GGGGATTGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGAACCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATC
CACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATACTTTGTAGCGG
CGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGC
TGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGATCGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCAC
CCACCTTAACCGATCTGGCAGTTCCCAGGTTTCACCGGGCTCGATCCAGGTTGTCTCATCTGCCCTTATGATCCTCATCTTCGTTCCATACAACGGTCGC
CGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAGCCTCACTCCGGCCGGTACCATGAAATACATCCCGAGGA
TGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTTGTACGGTA
TACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCA
CCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCAC
GGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTAACCTGACAAACCTCGGGTGGATCTGCAGTGACCTCACCCTT
GGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCTAGGGTTGAGGAGACTTCGGATCTGGCAGAC
TCATCCAATTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCG
ATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACT
TCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCACTGGCGGATCTGATTGTAGAATTCCTCCATCGGACAATTGCCGACGTCATGAATCTCGCCAC
AGCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTTACACAGACCAGATGTTTCCACCATCCAGACTCTGTGTGCTTCCG
GGATCCGCACTGCGAGCATG