Description :
From Genome Similarity Track
Location :
Scaffold_73:34114- 36130
Sequence
2016 bases(100 bases per row)
CTCAAACAGCTCCCGCACCGATGCGAACATTAAACAGGTCTTTCCACAATCTTACGGGGGCAAACGAAATTACATTATTGTGCGGCTTATGCTGTGACCA
TCAGCTCAACCCGAAAAAGGGTCGAGGAGAGCGGTGCCCCCTAATGGTCGTGCAAGTGTGCCGCACTAATGCAGAGTCGAATCCCCCGTAGTACCGGTCA
CCATGTCCGCCGCCAGCGTAGTGATGGACTCCTCGCAGAGCCTGGTGTATGACTTGAATGCATCAGAGATCCAACGCCCATGGAACTGGATAGTCAGTGC
GTCTATGCCGCAGCGATACATATGCGTCGCGCCGCCGGAGCGGAGGGAGTGGCAGCTGAATTGCCATGGGTCCTTCCCAGTGGACGAGGCTGCATGCTTG
ATCGCGTCGGCGACGTCCGCAGACGAAACGCATGCCGGGATCCCTCTCCAAGACAGGTACACCGCCGCTGGGATACTGACGGGGAGACTCTTTCGTGCTT
GAAGAAGGATGAGCGCGCCAAACACTGGGCAGAGAAATGGATGTCCAGACCGTGAGAGCATTCTTGTCGTCGGCGCGCCACCTTGGTTCGTCTTCGACCC
GATCAGGCGCAGGCACACGGTTTGGGCAAGCTGCGGCGAGAGCGTCGGATTGCCCGTCGAGTCGAGAACGACGAATCTTGGGCTCGAAGCGCAAACCACT
TGAAAGAGCGACTGCTGATCGCCGCGATTTCGGAACGCCTCAGAGGGAAGAAGAACACCAAGCACAGCACCCCCCAGAGGGCTTGGTCAAAGGGATCGTC
GAATGCGAGTCTGTGGAAGCACGCTTCCAGTAGGTCCCGAGACACTGGCGCCTTGCGTTGACGGGCGACGTCCAGGCGGCCGATCCCTTTGAGCAGCATG
CGAATGTGCGGGTGTGTAAGCGGGAATTCGTAGCCGAACGCCTTGAAGAACGCCCATGATAGACTCACTGCGGATGGGGCCACCCGAACCGAAGCCGTAC
TGGAAACCGTGGAGCACGAAGTCGGAGATGTGTTGTACTTTCTCCTGAAGCGGAACGCCGGAGAGCCATGTAGGAATTCCCCGGCGGGTAGACCAAGCCG
TCCACTTGCTTAGAGATCGACGGTATTGATCAAACGTGGAGTCTGCAACGGAGTGAGCTCGGAGATACGCTGCCAGATCTTGGCCAGCCCTTGTATGTCC
ACAGTCGGAGTAATCTGCGACCAGCCCGGAGTTAGTGAAGCAAACAGCTCTGCGTAAGACGAATTAGCTGGTAAGCGGGAGCCGGTGTCTGCGCGAGTAT
TGTCGGATCCGGCGACGTGGGACGCTGAAAACCGGAGATGATATGATGCCTCTTACCAGCTAAGGAGCCGAATGATAAGCTGAGCGCGGGGGTTCCGTGA
TGCCATTTTGTTCTGCCAGGCGACGGCGGAAGTGTTGTCAATCCGGAAGTGCACATGGTGAGGTCGGCCGTCTTGCCCTGCGAGGATAGACCATCGTTGT
CCCCAGGCGTGAACCGCGAATGCGCACGACAGCAGTTTTCGGAAGTTGATGTCGAACCCGTTAGCGACGCCAGACTTGAACGCGTGAATATGATCCAGCT
CGTCCGGCGAGAACGCGTAGGTTAACGCTGAGCTAGATGACACATCCAAGGCGCATAGACCAAAATCAGAAGCGTCCATCTCGACCACCGTGTCAGGCGG
AGGGAGTGCGTTGAACTACTCCAACGAAACGCCATTGAGATGGGGAGTATGTAAAATCTGCCACCACCACAGTAGATCCTGCCTCATGTCGTCCGTGATG
GAAACGCGCTGGAAGCGATGGAGTTGGCTTTCTCGTACTCGGAGTCGCTGGAGAAAGGGCTGGGCAGCGCGGATACATGTAGCCACATGACGAAGGCTCC
CCATGAGTGACCTGTACGCCTTACGGTTGAGATGTGACGCGATGTAGGCCGCGGCGACAATTCGACGGGCTTTCTCCACTTTTTCTGGTGGCATGGAAAC
GCTCTCGGCGACGGAG