Description :
From Genome Similarity Track
Location :
Scaffold_48:341101- 343814
Transcript NameFunction/comments
Physo_136818reverse transcriptase

Sequence
2713 bases(100 bases per row)
ATCGTCGAAACGGAGATCGTGGCCCTGTTGCGCGTCTTGAACGAGTGCTACACGATGCTAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACACGACGC
TCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGGCTGTCACAGTGGGCCGCGATCCTCTTGCCGTGGAAGCTGGAAATCTGCCGATCCATGAAGGG
AGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACACCGCGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCCCTCCGGAAACGGGCGTCCAGG
ATTGTAGTCATTCCAGTCCCCGACGTGGAGCGCGACGAGGTCTTGCACGTCTTGAGCTTCGACGGATCGGCTAAGGCGAAGCGAGAAGGCGGAGCATACA
GTGCCGTCATTTGGCAGCTGCCGAACTGGGAGACCGTGCGCTCCGCGTCGGGATATGCGACGGACCTCACGGTCAACGAGACGGAATACCGCGGGCCGCT
GCTCGGATGTTCTCTTTTAGAGGAACTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTGGTCATCAGGCAGATGCGGGACGAGATGGAC
TGCAAGTCCCCGGGGCTGAAGCTGCTGCGACGAAAGATGCGAAACGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACG
CGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGCCGCAACGCGCACAGTCCCGAGGAGATGCAAGATCTGAAGACGCTGATTCGTTT
GGAAGAAGTCATCCGACCACGGGCATCGAGTCCTGAGATGGCGTCTCCAGTCAGTCTCGACGCGGAAAGTCTCGACGCAAAAAATCTCGACGTGAAAACG
AGCGGCGCAGATGACCCCGTCGGGAAGGCCATGGACGCGGGACGCGGGATAACACAAGTCCTCGCGGTGACGACGCGTTCGGCTGCCACACGCACGACAA
CACGTAGGGGCCGACCTCCAGAAGTCCTGGAGGAGCTAGTGGTGCATCGACTGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAGGCCTGGATCGT
CAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCCAACGCTTGCGCCTCAGTACGAAGAGGGCGAAGGC
GGGCTGCTCTACTACCAGCCGAGAAGCGACAATTCCGCCGAGGATCGCGATGTGATGACGAAGCTGGTGATCCCGGAGACTCTTCGGGAGGATGTACTCC
ACCACTATCACGCGATCCTGGAAGGCGGACGCCAGGGTTTTGGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGT
CCAGCGCTACGTCGGCGAATGCACCGACTGTGCAACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTC
CAGGTCATCGCCATGGACTATATTCCGTCGTTGCTGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGG
TCAAAGCGAACGCGTCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGTGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATATGCCACGACCG
CGAGCCGCGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTCACTTATCGTCCCCAAGCCAACGGTGCT
GCAGAACGGATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCGGACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTCG
CGCTAAACACGTCGCACGACCGGACGAGGAACGAAACCCCGTTCTTCTTAGTGCATGGCTGGGATCCTCGGTCGACGCTGGAAGCGACAATGGCCGTCGG
GAACACGTCGACCCGGGACGCCGAGGCGAGGCGGTGGAGGCTCCGCATCCAGCGACGCTACAAGGTGCCAAGGGCAAAAGCGTTGGAGTTAGTCCGAGAG
GCCGTCGAAGAGAGAGCGCGTCGACAAACTGAAAACGCGACGCAACATGAGATCGCGACGGGCTCGCAAGTTTTGCTGTACCTGGATCGGGTGAAGCCAG
GGTATGCCCGCAAACTCGCCCACATGTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGACGGCGGGTACGCCCAA
TCAGCTGTACCCCGTCGTCCACATCTCCAAGCTGAAGCCCGTCCGGGAATTCCTGTCGCGACCCGCGACGCAGCTGACGGTGCCGGCCGAGGAGCGCTTC
GACTTCGACGAGGAGCTCTTGCCAGAGGATAGCTGAGAAGCCACGCGCGAGCTGGAGGACGACGTCTTCGAGGTCGAGAAGATCGTGAACGTGCGCGAAG
GGCGGGCTACCCGGTATGGGCGCACGCGACGCGAGTTCGAAGTCAAATGGAAGGGCTACCCGGACACGACGTGGGTCGACGAGCTCGATCTGAATTGCGG
CGGGTTGCTGTACGACTTCCTGCGCCGGTGCACGGGACGCAACCGGTTCGAGGCGATGCAGTCGCACGAGAACTCGGAGGCGGCGGAGCCTGGTGGGTGA
GCGCCCACGGGTG