Description :
From Genome Similarity Track
Location :
Scaffold_270:34104- 39021
Transcript NameFunction/comments
Hyaar_Emoy2813393hypothetical protein

Sequence
4917 bases(100 bases per row)
CCTGCTAACCCCCTCCCTATATTCTCTTATAACCCCTGTTCTTGCAATGATAGCTTCTACCGGGTACGAACCCCCACCCGCCGAAACAGTACTGGTCCCC
GCTTGGACTCCGGTCCCTCCACCATGTAGCTTGGAGGTGTCGGTCGCTCCCATGCCCCTGGTCAGTCCGTCCTATGACGTTGACACGTTGACCCCGGCGG
TGGACTCCTCGGTCGCGGTGACTCAGGACAAAGAACCTACTGTTGTTGCTGTAGTCACTGTGGCGATGCCTTCAAAGGTTTCTGCGGTAACTCCGGCCGT
TCCAGCTTACCCCTCCTATCACAGTGACCGCTCCCGAAGACATACGCCAAACCATGCTGGATATGCGTGTGGGCATGGCTGAAATGACCAGCCGCATCGA
GGCTTGCGAAGATCTACAGGTTTCTATCCCCTCTCGTGCGACCCACTGGGCCAGCCTGGTCGAGGATATCTTACTTGAGCTGCGCGCCAGCCTTACTCTT
GTTGGCCAGTAGCGTAGGGGTCAGCAGCGCGATAGGGCATTAGTTGACCATCTTCGGTGGCAGGTCAAGTATTACCGGAGTCGGTACTACCTCCTCGCGT
CGGAGCTGGACCACATCGATTTCTCGGCTGGACCCTCGAAAGTGCCTCTAGCAACGATGGATGTGGCTACGGGGTCTGCGGCCGATGTCCGCCCCGTTCA
GAAGTCTGTTCTCGGCGCGCAACCGTCCCCTCCTAGTTCCGGCAAGTGACCTCGGCGATCATCTTTCTGTTTGTCGTTCCATACCAGCAAATCGCAGATG
TCTGGTGCTATCAGCGGCCGACCTTCTCCGTGATCAAGTACGGGTCTGCTGGTGGCCGTTTGTCCCCAGTTTTGTCAGATCCTTCCAGTGACGTCTCTAG
CAGCGGCAGCGAGGTTGTGCGGGCGACCTTGGCTAAGTCGCAGTCATCCGGTCGACGCCCGGCCAAGGTTTCAAAGCCTTTGGTCTTAGCGCCACCAACG
AAGTCCACAGGTCTCCCGGCCGTTTTGTCGCTGACCAAGACTGCAAGGCGTCCAGTTGCCGCGCCAGCATCGTCCTCTTCCCCCTCTTCAAACCCCTTGT
TAAAACGAGAGATTTTAGCGTCTCCCGATCCCGACACCAAGTCAGTGTCTGAGAAAAAAGATGTCCCGGCAGCCGGAAATGACAACGCCATGGACCTTTC
ACTCGTCCACATTCTTTTAAAGACGTCTATGATTCCTGGCCCTATGCGAACAAAGACTTCTAACCGTGGAAGTGTCGCCTCGGTCCCTGGACCTGGTCAT
CTCGTGGTGCAGTGTGACGAAAAGTCTAGGCGACTTGGTCGACCGTCTGGAATTGCCATGGGGTGGTTCGGTCCGCTGGACGTTAAAATCGACCGTCTTT
CCAAGTGGAAGTCTTCCTTGGTCAACTACGCTATGGTCAAGGGCTTGCTGGCTGCCTAGCCTTCGGTTTCCGCCAAAGTTCCTCTTCCATCTGTGTCAAT
CCGACCGGTAGGCTGGTTCGTCATGTTGGCTGCAGCCTAAGAGCGTTCCGACGACGAACACATCAAGCACTTTGGGAATCAACCCACTGATTATGGATTC
CCATGGAACACGTGCGTGAACCCCTTCCTCGCGTCTTATCATAAGGCGCAGAAAAAGCGTCGATGTCGAGCTGCTTAAGCATGGTGGGGCGTGGTCGGCT
TGATTTTGAAAGGATAAGCGCCTGTCAATGTGATCTTGACATCTTCTTGTACCACTTCTTCCGCCACCTCGCTCGACCTCGCTGCGTGGTATACTGGTTC
CCGGGGCGTAAAGCAAGGTCAGATCCGGTCAACCTGCTTCAGGATCTTCGGATCTCTAACTCTGCATCGCCATGGCTCATGTAATATCGGCTGTCTTCGG
AGCCACACCCAGGGACGTTGGTCCCTCGTAACAAGAACAAGTTTGATCCGTCTTCCCAGGATTTAAGCGCCTGAATACACTTGTTTCTTCTTTTCTAGAC
GTTGATTACTTACGTCTCCACTTCCTTCTACCTCGTTAGTCATTTTCTTTGCACTGGGATAAGCCGGGTGTATCTCGACCTCTTAGGAATACGGTCAACC
TTAACAGACCCAAGTCCACCCACGAGGGATCTAGATCTACCGATAAGGGATCGTGGTACACAATGAGGGACCCTCTCTACTAGTCATGGACCGTATTCGA
CCTCTTGGGGCTTTCGAGACGCGCCTCTAGTTTTCATAATCCACCCTTGCTTCCAAACGATCATGACTCATCTGCTTACCTTCAAATTCTTGAAGTAAGG
ATCCACAATTCAAATCCGGTTCATCTACCCACGAGGGGTCCTCATACCCCTCCCAACGACCGAGAAATTCTCATTGCTGTCGCTTATACCACACATCTTA
CCAGTACAACTTTCCAGAATTTCAACAACTTCGTATTTGTCTTCCTCCAATTCTCGTATCCAGCTATATTTTAGTAATAAGCATTCGTCGAAGTCGACCC
AGTCTGCATGTTCCCCAGTTAGTTCGTTGTTACTGCCTGGTCCACTGATCGTTCGTTGTTAGGTCTATCAGGGAACCTCCTAACCCTCTTGAGCTTGGAT
ATGTGCACGATCGGAAATAACCTATATTTCGTACCCTGGTTTCAAAACGCACTGCGCAGTCTTCCCCAGCTCCAGAACACGGAAATGTCCATTCTAAAGG
TAGGACAGTTTCCTGGCATATTTTTTCTTTCACTTGATCGATATAAAGCCATAATTGGGTCCCCAGTCGGATTTTGGGTTCGGCCACCCCCTCGTTACTT
TTTGTGCTCCAGCCTGACTCGCTTCCCGCCGTTTCTCGTTCACCTGTTCTCTTGCTTGCTGATACTGATTCTGAATGCAGTAAATACACCTTCTGGACCC
AGAATCCAGCGGTAGACATTCACTATGGGTAACGTGGTTTCAAGGGTAAACCTGGCATCCCAACCGTTGACCAATAAAACGGTGTTATCTTCCGCAACCG
TTCTTGTGCGGTCTTGATCGCTAACGTCAAATTTTCCGCAACCTCGCTCCAGTCCCGTTGCCCTCCACGGCGACATACAACTTGATAACCCAGGTCAGAG
TCTGGACCATCCTCTTCGCCGTAACACTGGCCTGAGGTCAGTAGACCATTGTCGATTTCTGATGTTGGCCCAATATACGATCGAGCGTTCAAAGTAATTC
GACATAAATCCCGGTTCTCGATGATTGCGGATCGCCTCACTAGCATCAAAATGGCGGAAAACACACTCTTCATATCCCTTTTCAACCGTGAGCCGTCCAC
GAAGCACCAGCCTTGGCCATCACGTATCCGATAAATAATCAACCCGTAACAGCGGTTCTGTATTTTCTTAGTGCGACAGACGGAATATGGTCCATCGCTA
TGATATGGAAAGGGTAAGTCGCCTCGATATTCCCAAGGCTCTTTTCTTGTTGGGTAGGTCCACCCTTTCAGGTCTCACAATCCATGCAGGAACCCACACA
TCTCTGCACACTCCGAAAGAGACCTTTCCAGTGGCAGTACCGTCATATGCGTTGGTAGGTACGCCTGATTTCTTGATGTCCCCCTTTTAAACTCGTGTGG
TAGTGGTGGAGAAAGTCGATTTGAAGACTTTCAGGTATCACCAGCCTGACTGTCAAACCACGACCTTCTCCCTCGTCTCTGGGGTTGGGGCAGTACACCA
ATAATCCTTCCTCGCTTAAATCGTAATCTCTGACATTTTTGATGCAGGATCTAGCATATTAAATAGACAGGTCACTCCATTCTCCCTTCATAAACGCTTT
CAAATCTCGTTTCCAACTCTATTCGTTTGCGCCTTTCGATTTAGGTCCACTCGGAGTCGTTGCACAACCTCCTCTTACATATGGTCTTCCCGGGTATCCT
AATGGAAACCGCAACCGAATCATCGCACATATTTTTGTAGAGGTGATCTAGCCTATAGGGACCAGCAACTCCGGTAACCGATTAATCACTTTTAAACCTG
GTCTTTCCTTAATCGGCGTCGACTGACCCCCTCCTGCTGGTGCAAAGCTGTACTAGCCAACTGGTCTCCACTCTGATTCTAATCTCGTTTCACATGTAGA
ATCCCATGAGAGGGTCACGGCTGGAGTTCATCAAAATCCCGGGCTCGTAACGGGGACAGGCCTGGGGCTTTATACATGATCTCTCTACGCATCTGCCGAC
CCGCTACATCGGATTCTCCACAGATAATCAATCACCTTCATTTCACGGGTATCAACAAGTTTAATCCTAGCAACATACCCTCATCTTCTGCCTTATTTAC
CGTAGACGTGTCAAGATACTCAGAGGCGGCTTCGACTATGGTCCATACTGGAAATACCCATACGATAGCGCTACAAGTCCCACCACCTTGTTTTACACGG
GCCATCAAAACTCATTACATATAATTCTTCTTCCAGCTCCACGGTGGGGGTAGATAATTCGATCGTTTGCTTTGCCTGCTTCCTAGAAGCAATAGCCGAC
AGAATTGAGTCTACGCTCCTTCGAGGGTTAATATTGGCTGCTAACGCCCCCAGCACCTGGTCTTCGAATTTTTATACTACACTATATCTAAAGTCCACTG
GGATAAAGGGCAGCCCAGTTTATCAAGCGCCCCTGCAAACCGGCAGATTTAACTAATCATGCCAATGTCGAATATCTCGTCAAGACTGTGAGGGGCCGGG
TGACCAACATGGTCAAACAAGTCTCCAATATACGTAACAAGGCTAACACTTTCTTTTTTAACAGTGCTATAATTAAGTTCATTAGCCTTAAGGGTCTCGC
TTGTAAAGTTACCGGCATAAGTAGTCCTTCGTGAGTTTTTTGTAGGTGCATTGGGTACATTAAGCATTTCTAACGACCGACGTCTGCTCTCTTCGGCGGG
TTCTACACCTCCCCTAC