Description :
From Genome Similarity Track
Location :
Scaffold_181:341- 2125
Transcript NameFunction/comments
Phyag_g3157cysteine protease family C01A, putative

Sequence
1784 bases(100 bases per row)
ATCATGGTGGTCTGCAACGCTGCGCGGACAGAGCTGTCTAGATTCTTAACAAGCGCATGACAAGCCCCTGGTTATGCCTGCAAGAGAGTGTGGCCGCAGC
TTTTACTGTTCGAGCAACGTTGGTGTTGTTAGTCGGAAGGTGTCGTGCACACAACAGCACGGGCTTTCCATTACAATAGGTAGGTATCATTGTTGTCCTA
GTAGTTCGCAGACGTTTGCGCCGCGTACATGGCCGAGTTCTGCTTGCGGAGGATCTTGAGCTTCCGCTGGGAAACTCCGATACCGATCGCCGTCGAGACC
AGCGTGAAAATGGTAGTGGCGGCAGCGACACCGATCCACCCTGTTGGGCTCAGACCCACAAAcaccttgtcgccgccgctgtcgATCGCGGTGCTCGCCT
GTGCGCCGGCCTTGGCGCCGGTAGGGATAACGGGGAAGACGTTCAGCCCGCAGTTGATCTTGGCGTCTGCTACGAGTTTAATAAAGCCGCTGTCACCCCA
CGAGCTGCCGTACGAGTTCTTGAGGATCCAGTAGTCGCCAACGGAGGAATCGGTACCATAccccacgagcagcagagcgtgaTTAAGATCGTTCTTGGAC
GCCATAACGCCGTCGTTGGGGCAATTGTAGAACCCACCGGCGTACTCGCCAAAGCCTCCATTCGACGTGATCGCTACAGCAATcggctgcttctccagtg
ctgagcgcagcagcgtcgtgcaGTTCTTCGAAGCTGTGCAGTCGATACCTACGATCTGCTCCCAGCCTTTAATGCTTGCGGCAGCCTTATCCGCACTGAC
AGAACACACGGAAGAAGAGTTCGTGGCCGACGAACTTCCTGAGCTAGAATCGTCGTACGGCATCGTGAGCTCAGTTACAAGACCCCAGCCGTTCTGAGCT
GCGTCCATGAAGGCGCCGTGAGTCATGCCGCCATTGCATCCGTCGTTCTGCGATTCCCACTTGATTTGTGTCTGCATCCAACTGGCGCCATCCACGCCGC
TGTCCGAAGCCCAACAGTAGTCGAACGTTTGCGTTGTCTGCAAAGTACTGCACGTCAAGAACTGCTGCGGGGAGAGCGACACAGCGGCTGAAGCGTTTTC
CGCGATCACGACGGCCGTCTCGAtcgcgtctgcagcgacgaaCGACCAGCAACTTCCACAGCTCTTTTGGCTCTTTACGGGCGAGCACACAGTGTGACCC
ATGGAGTTCTTCGAGTCGCACCAGTTCCAGTATTCCGAGCTGCCCGAACTCGATATCGTGCTGTTACTGGTAGCGTTTGTTGTGGTTTGGAGACGACGGG
CGTGTGCGGAGATCATTTCTTCGTCCACGAATTCTTCCGGCGTCAACTTGCGGTGAGGTGACGAGGTCAAGTGACGCTCGTGCACCCCCATGCGATAGGA
GAATTCATGGCCAACTTTATTCGCGTACATATTCACATCTGCAAGAACAAAGTACCAAAGTGTTAGCATCTGCAGACCGAAGAACCCTTCGTTATACAGG
ATATACAATACCTTCGATGTACGTCATGTGGGCTTCCAGGTTGCGCCGGTAGGATTCTCTGTCACTGTAGACGACGTAGTGATGTTCGAGTAGAAGTTCT
CGTAGTGCACGAGCGTCCACAACTTCACCATTCTCTCCAGCCCAAAGGCACGGTGAGTCTGCTGAACGAACTGCAGGGCACTCCACGAGGGTACCCAGTG
ATCGATCTGTGGTCTGAACGGCAGCGGTGTTAGCAATCACCGCAGAAACCGCGAGAATAATAGCTCGAAGTTTCATGCTGATTG