Description :
From Genome Similarity Track
Location :
Scaffold_153:34090- 36159
Transcript NameFunction/comments
Phymu_g5628hypothetical protein
Phymu_g5629ribosomal RNA assembly protein mis3

Sequence
2069 bases(100 bases per row)
TCCTGGCCTCGATCCGCTCGTATCTGCTGCTGTAATGCGTGTCATTGTATGAAATCGAATCGGTagaacttccacttgcttgTCAAACTTGGAGGTCGTC
TCTGCACCCTTCAGTAATGGAAACCGCTTGGTGTCCGAATTGAGAGCGCCTCTGGGGCTAACGTTCACGTTGGACGCCTGCGAGGAGGACAGGGACGAAC
TCACCGGGGTGTTGTTACGATTTTGACGCCCCGACATGGAGTCTGCTTTGATTTGCGAGGTAAAGCGGATCCTTTTGCTGATTGACTCAATGTATCTGTA
GTATTCACGCCCTTTCATGGCTCTTCAACATGCCTCTCATTCCATATTTCACTCTACATATTGATAACGGGATGAAAAAACGATGGAAATGAAAGTGGTT
TTAGCGGAAATGTCATGGATAGATTTGAGTCTAGTTACGCGTCAGCCTTCTTtgatttcttcttggccggtACAGCAAGGTAGTCGTTCACGGAAGAAGT
TGCCTTGGAGtctgtcgtcttcttcgtgctctgctgaaataaaaaaaaagtgttaGTAAAAATTGTTCGGCATAGATACTTCGTGCAGTTACAACGTACC
TTTTGACTAaggaacttctgcttgagGGCTTCGACCGAAGTGGCGCGcttgttctcttcctggGCTTCAGCCTTTtgtttcttgcgcttcttgctggtct
CCTTCTCACTGGGCGCGACGTACTCGGCCATCTTGTCGgacttgcgcttctgcagcacttgcaccttctcctcgtgcttcttggccttgttCATGGCCTT
GCGCTCGTGCTCCTTCATGAAGTACTCACCActctcgatctccttgtccaccTTGCTCGCCGTAGGAGCCGGCGGGAACGGTGTGTACACCTTCTTCTCA
CGCaccttcttgggcttcttggtctgcacgttctgcttcttgaacgtGGGTAAGAATCGCTCCCAGTTCTCGTCTTTGAGCTTAGGGTCCTTGGCCAGCT
CGCGCTTGATCATAAGACGCTTCACGTTGTAAATCGGGTGCACGTTAGCGAAACAGTCCTCCACAATTTTTCGGACGTTGCGCAGGCCGTGGTAGCTACC
CATTGCCGAAACGGTGTTACCCTGCACGAGAACGTAGCAATTggtgagcagctcaatggcCTTGAGCGTGGCTCCATCAGGACCAACAAGACGTTGGCGG
CGTTTCACGAATCGCTCTTTGTTGCGCACCATACCGCCAATCTTGATGATGTCGCACTgcacgtcgtcctccaggATCTTAACAGCCTGGTTCACGGGAA
TGCTACGTGCCAACAGTTTGATGAGGTCGCGTGCCTTGAGCACGATGTACGGGTCCGTAGTCTTGCGGGAGGTGCGCACCGTCATGCTGCCTTCAACTAA
GTTGAGCTCACACGTGATCTTATGCGCATCCAAAGCCTTGGTGACAATGGGCCACACCTCACGCAGGTACTTTTCACGGTACTTGGGGAAGAGCGTGGCG
AACGAACTCTCCTCCAGCAGACCGGgcatcttgatcttctttCCAGCCTGCTTCTGGtcatccacctcgtcctGCCATGGGTCGATTTTCCAGTGGTCTA
TGTCCTCGTTGTCCCAGGGTTTGTCCTTGCggtggttcttcttctcctcgcggGCCTCCGCCTCCAAATGGTTGCGCGGTGCGTCTCcgtcgaactgctc
catcgtcgctggaAGTTGCAATGGACCACGCGACCGCCAGCCAAATTCGAGGAAAACCGGTAAAAATGTGGTATGAACCGGTTTTTGATTAAGCTGCGTT
TCCGATTTTTTAAAAATGTTTTTGTGTTTTATAAAAATGTTAACGCTTTTGAAGTAGAACGTGTTCTAGAACACACCCAGCATTTGATACTTTTCGCGTG
AAAGGAAAAAAAGACACATGTACAAGTCGTACGACACGGCACTTTCGTGTTTGCCTCTTGAGCGTTGATCTAGACTGCAGTCTGTGTCTTAGTTCTTGCC
AACGTTATCAGATGCCTGCGTTGCCGAAAAAACTGTACTGTAGTCACTACCAGTATGCTTGTGAACACT