Description :
From Genome Similarity Track
Location :
Scaffold_16:340870- 349213
Transcript NameFunction/comments
Phyra_76157Coatomer protein complex putative
Phyra_76158PREDICTED: WD repeat-containing protein 82-like
Phyra_76159secreted endo-beta-1,6-galactanase
Phyra_76160secreted endo-beta-1,6-galactanase

Sequence
8343 bases(100 bases per row)
ACGTGGAGCAATCCTACGTGCTCCGAGTTCACGAGACGGCAGGCAGCAATCGCTTCGTTGGCTGGAGAGTAAGCAAAGTGACAATGTTAGAGCTCGGCCA
CACAACGCAGAATAAAAGAGTTATGCGACGTACTGGTTGGGATGGCTTCGACGGTGTGCACGTTGAACTGGTGCATGCGGCCCATGAAATCCTCGAGCGT
GCGGATGCCGCTCGGGTTCACCTTGGTCTTCTGCTCGCACGGGCACGCGCCCCAACGGCCGCCGAAGTCCTGCGTGGTGATCTGCCACGGCTCCAGCTGC
CGTCCATTGTACTGGAAAACGCCGGTGCTGCTGCTACTGCCACCCAGAATATCCAAACCATTGGCAGGGCTCTTGCCAAGCTCAACAGCAGCTTCACATA
CAAACAAAAGCAAACCAAGCCATTTAGCAACCATCCACCATCCTGATGCATCAGAAACCTTTCCTAACTTACCATTCATGCTTGAGCCGAGTCCAGACAT
GTCGAACGGATCCAAAGAAGCAGAGGGGGCCGGCGAGCTCGCCTCGCGGGCCGGTGCTGGCGCTAGCGGCGAACCCATGCCAAACGGGTCTGCGTTCATA
ATCGGCTGCTGTGGGGGCGGTTGCTGGAACATGCCTATGTTTTGCGGGGCTGCGGGTGCGTCAAACGAAATGTCGAGCAGGTCCATTTCGACCTTCGGCT
GCTGCGGAGGAGGCGCTTGCTCCACCGGTGCTTGAGGTTGAGGCGGCAGCTGCTGCTCGTTGCGGTTCGATGAGCGCTTCGACGACGAGCGGACCGGGCG
GCGACTGGAGTTGAGGGTTGAACGCGTACTTGATCCCACGCGACGAGCGCCAGGCATCGGTGCCGGGGCACCAGGAATGCCACCAAAGATCGCGGAAGCC
AGGATCTGTCGCTCGTCAACGTTGCCATTAGATTCGTCCTCACTCGTAGGCTCACCGTTATCGTAGCTGTTCGGGGCACCGTACTCCTGCTGCGGTGGCT
GCTGAGGAGGCTGAGCACCGTAGGCGGGCTGACCACCGTATCCACCCTGGCCGCCATACGCATGTTGGCCGCCGTATGCAGCCTGACCGGGCGCGGCTCC
CTGATTATACGGGTCGGAAGGATAACCTCCAGGAGCGCCGGCACCCGGAGCTCCGGGAGCTCCGGGTGCAGCATTATCGGGCGTATTGAGACCAGTAGGA
CCCCACACGTTCTTGACCACGCCGCGCTTTCCAGCGCCAAACCCTCCAGTAGGATCAGGGCCGCCAGAACTACCCAAGCCAGGCATACCACCCTGTCCAC
CATTACCACCCCACTTGTTGACACCAAAGGCGCCTTGCTGGTCCGCAGGAGGGAGCTTCGTCGGGTACGGGATCTCGGGCTTCTTGTAGGCCTCAAAATT
CAAGCGGTTCGAGTCACCGCCATTGCGACGGTGGCCGTAACCTTCATCCTCGTCGTCCGAGTCCTCGGGAGGGTCGTAGAGCGGTGCTCCTTGAGCCGCT
GCCTTTTCGACAAAACTGGTAAGGAAAGAAAGGTTGGGATCAACATCAATGTCCTCGCAGCTTGCATCTTCCGGGAAGACCTCATTCATAAGGGAGAAGT
TCTTGGTAAGAGCAAGGTACTCAAAGCAGCGCTGCTGCAGGTCCGTGCTACGACTGGTCTTGTACTTATCCATCATGGCGTCGGCCATATCGATAGTGTG
CCCCATCTGCGCCGTGATCTTGGTCACGGCTGAAAGCACGTAGCCACGAGTAGTGTCTTCCTGGTCGAATGGACGGTCAACAAGCTCCACAAGCCGCTCG
CAGATCTCTTCCAGCTCCATAGCGTCCGACAGGTAGCCGTACTCACCAAGGACCCAGGCCATCGTGCACACCAGAATGTCCGGCAGCACAGGGCGCTCCA
ACAGCTCCAGGTAAGTGTCGACAGCATCACGACGAAGCTCCATGTCCTGGTCTTCATCTTCTCCACTTCCCTCGGCAATCAGACGCAGCAAGTTGTGCGC
CACCTCGGGACGAACAAGGTCACCGCCCAGTTCGAACACATTTGTCATGGTCTGAATGTACCATGCGTTGCTGGGCGCATAACGCTCGGCGCACTGCGTA
ATACGGGACACAAGTTCCGTACGCAGGAAGACGTCCGAAGCTTCGCGAAGGAACTGCGTGAGCTTGTCCGAAATGAACTCAACATTCACGGGGTTCGTCA
TGCGGTACAGCAGATCCAGCGTCTTGCGCTTTAGCGTCTCATCCGGGTCCTCTAAACAGTCAATGACAGCCATTTGGTGTGCTGCAGCGTATCGAGGGTG
GTCCTTAACGATGGCAGCAAGTCCTGTGACACCCAAGTACTTCAGGTTGTGGTTATCGCTCGAGATGAAGCGCGAAATGCTAGCAGCCGCGGCATCCAGC
AGTGTGCTGTTCGGGTAGATGGTAGTCACCGTCTGCACGCACTCGTAGATGATAGCGTAGCCCACATTGATCCCAGTGTCAGCACGACGCATGACATCGT
GCAGCACCTCGTACATTCCTTCACTGGTCTGCTGGTCAGCCTGGCCCAACAGCGCCAGGATCTTCAGCAAACGAATCTGGATCCAGGGGGCCGGGATGCG
ATGGTAGTCGAACTCACGAGGCAGACGGTGCTCCGTGATCTGCTTGAGAATACTCACAAAGCTGGGCACGAGGTCCTTGTAGTCCGTGGGGATGGCCTCC
GCCAGGTCGTGCAAGATGCAGAGCGTAGTTCCCATGACACTGGGGTCGCGGTCACACAATGTGCGACGCAGCGCGTCTCCAACGTCGCTGACCGAGTCCG
GGTTGAGCTGGTGGAAGCGATGGATGGCCATGACGGCCTTCTTGCGCACGAGCTCGGCGTCGTGGCGCAGCAGGTCGAGGATCATGGGTTGCACGGCCGG
CACCATCTCCACCGTCACGAGCTTGCAAACGGCCATGAGCGCCGCGCAGACCTCAAGGTGGTTGGAGCTCTGCAGGTCTCTCTGCAGCTGGTTGATGATC
ATGAAGCGGAACTCGTGCGTGGGCGACAGACACAGGCTGCACGTAAGGTAGCCCACGCGCTTCTGCATGAGGTTGGTGCTGGCAGTCATCTCCACCGCCT
TGATGTAGCCGAAGGACGCGTCGTGGCCCAGCATCTCCACGTACATGAGGCGAATGAGGAACTCGCGCTTGCGCTTGTTCACAAGGCTGCTGGACGTGCT
GGACGACGCCGTCACCTCGTTCAGCTTGCGCTTGAGCTGCGCCACCTCATGGATGATGATGCGGTCCTCCTCTTGCTTCGACTTGCTCTCGCCGATCGAC
TTGACCAGCTCGAAGAACTCCTTGGATAGGTGCCCGCCCGACATGGCGCGAAGCTGACGTGGACAGCGGCGAGATCGCGGATTGAGGGGGTGTCGGCACC
GCGCCACGTAGTGTGGTTGTGTTGGCTATCCGACCAATACGATTTATTTATATACGGGTTTTTAAATAAAATGCAATAAATATTGGCTTTGCAAAAGTAA
ATCTTTGTAATGGTCGGATAGATGCGTAGTTTACGATCGCCCTATGGTGTGGCATATTCCGTCGAGTGGCATATTGTGAGCTCATAAAGTGACGATGGAC
GGCGTGGAGCTCTCGGACGGAGTGCTGCGCTCCTACAGCGTCGCACGAAACTTCGTTCCGCAGGTAGGACGTCGGTCTGCCAATAGCTGCTACTATTTGC
TGGTGCGTACCGTTATACTGAGAGTGTTGTCAACTGCGCAGGAGGACGAAGATACGAATGGGCAGATCACGTCCCTAGATTTCCATCGCAGTGGCGAGCG
GTGCGTTACGAGTCGCAGCGACGGCGTCCTGTCCATGATCAACTGCTTGAGTGGAACGTGAGTTGCATTACGCGGTGCTCTCGTATTGCTGTCGACTAGA
CCAGGTGAGCGTAGCTGACACCTTGCTATGCTCTCCACAGAGTCGCCAAAACGATTTTGACCAAGCGATACGGCGTCGGCATCGTGCGGTTCACCCACCA
CCCGGACTGCGTGATCTTCTCTTCGGCTAACAATGCCAACGATCGTACGCTGCTGCGGTAGTGACTAACTGGAAGGTGTGTGTGTATCCTTGACAGCGTT
GATGTTTGTGTTTGAGCAGACCGCATTCGGTACCACTCGTTCTTCGACAATAAGTTCCTCCGCTATTACACTGGTCATACCGACAGGTAGCTTGAACCTC
TTAAGCGCCAAGCTGCTTATTTAGTTGGGAGTTAATGCTCATTCGGTCGTTGCATGCTCCCAGAGTCACATCGCTGATGATGCACCCCACCGCAGACCAG
TTCATTTCCGCTGGAATGGATGGCACGATTCGACTGTGGGATATCCGTAACTCAGACACCTCGGTGCGTCGCAGTCTGTGAGTGCCCTTATTTGCGGCAT
TTATCTAACCGATATTGTTTTGCTGTGTAAAGGCTATCATTCGAACCGATCACTTGCCAGTCTCGCATATCTGCGCTGCGTATGACCAGGAGGGTGTGGT
GTTTGGTGTATACACGGACGATCACTTGATCCGGATGTACGATGCGAGGAATTACCAGGAAGGACCCTTCGCCAAGTTCTCGCTCTATGACGCGTCGGTC
ATGGCAGCCGTGGAGCCGTTCCTCGCGCAGATGCAGGCGCCGAGCTTGAATGTCAAGAAGCTGCACGCACTCGACATGAAATTCAGTCCCGATGGTAACC
AGTTGCTCGTTACAACCAACCGCGGAGTGTTCATCCACCTCGATGCGTTTGAGGGCAAACTGCTGCATCTCTTCAAGGAGCATGGCTTGACTCAGAGTCA
GCGCAGCGAACCCCAGCTCGGTTGTTGCTACTCGGCCGATGGCGCGTATGTGGCCACGGGAGCGGAAGACGGCAGGGTGTTCTTCTACAAGAGTTCTACC
GGTCAATTCATGCACACACTCCCGCAGGGCCACAATGGGCCCGTGGTCGATTTGCAGTGGAACCCAAAGCGCCACCTTCTAGCAAGTGGTGGAGGCAACT
CGACAGTGTTGTGGTCGGCGGCTGGGGTATGAGGACTACCGTGCCGCAACAATAAACTTGCAAGTTTTTAAATTTTGCTACAATTCATGTCCTTGCCAAC
ACTCTGCCGCTACTGCTGAGAACTTAAGTTCTTCCCAGCCGTTGCATCACTTCGGTTGCTGGCGCGCGACCTTCCGGTTTAGTGAAGTTCAGTCACGTGT
TTAGTCACGTTGCTGGTTAAGAGTCGCACCAGAATTGTTACCGAATAGTGGTCTCACCAAACAATTCGTCCGGGTTAAACTTTTAATGCGCGACCATTGG
GAGGGGTTTTGGAAGGCACCATTGGGTCTTTCCGAAGTCGAATTTCATGCAAGAAAGTGCCAAAGCAACCACAAGTAGGGTTGTTGGAATGCTTCCAGTC
GCCCAGGCACGCAATGGGCGAGTATGAAGTATGCACGATTTACAGCAATTCGTACTCGAGTACGATTTATAGTTTTGTACAAGTCGTACGAATTAGAGGC
GAAAGAGCCAAAAAAAAAAAACTGCAAAGCACAATTCCGGTACATGTATTATTATTAATACAACACAAATTGGTTTTTATAGGCCTAATCTCAAATCGTC
ATCTTCAATCTCATCTGTTCGCACCGAACTCTTGCAATTTTGTGTGCCTGGCTCATCGACTCTACGTATGCACGAGTGCGCTCTTGCATTTCTATCCACT
TTGCTTTCGTTTCGCGAGCTGACAGTCGTCAGACATCCATACGACTATGCTGTACACTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTT
CCGCAAGTCAACTCGGAGGACTACACGGTCAAGGCCGATCCCGCTACGACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCA
ACGCCTTCGGAGACCGTGAAGACATCGCTGACCTACTCTTCACCATGAAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTT
CAACATCGCGCGCTACAATATCGGTGGGTCTGGCAAAAACGTCATCGACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTC
AAGTTCATCGAATCGTTTTGGCTCGACTGGTCGAGCAACGACACAGCCAGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACT
TGGCGACTCAGCGTGACGTTGACATCACGGAGGCGTTCTCAAACTCGCCACCATGGTGGATGAACAGCAACCATGCGACTGCGGGCGGGGACAGCGGAAC
AAAAGATAACTTGCAATCCTGGAATCATGGACAATTCGCGCTGTACCTGGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTAC
GTTGTGCCGTTCAACGAGCCTATGAGTACGTGGTGGCAGTATCCAGGTGGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGGATGTCGTATTGA
AACTGCGCTCTAAGCTGGACTACTTTGGGCTGCAGGACGTAGCCATTTCCTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCAT
GTCGACGGACGCAGATGTGATGACTGCCATCGGAAAAATTAACACACACGGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAG
CAGGTAAAGAAGAAGTTTTGGGACTCCGAGTACGGCGAGAAGGACGCGACGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCG
TGTCGGCGTTCGTCTACTGGCAGCCGTTTGACGGCGGGGGCTGGGGCCTCATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTA
CTATGCGTTTGCTCAGTACTCGCGCCACATTCGACCCGGCATGGCGATCCTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAA
CTCCTTGTACTTGCAACAGTGAACTCAGGCGACACGGTTTCGAAGGTCACTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGA
CGACGGAAACGAGCGGCACGGGTGCGCTTTACAAGTCCTCGAAGGTCGAGCTATCTGGCACGTCTTTCAGTGTGTCGATCCCGTCTGCGTCGGTGATGAC
TTTCGAGATCGAGGGAGTTACTGTTTAGACTTCGTGTTGAAATCGGTGATTTTGAACACCTTGGAAGAGTCTAACAAATAATGAAACGGATCAATTACAT
TAAGCTTTTTGTAATCATCTGATCTAATCGAGGTTGCGTGGTTGAGCTTTCGACACCAAGCAATGCGTGATCTTTCACCGTGCCACAATCAACGCTTCAA
TCATGATGATCACTGCCCTGTTCTCAGGTTTTTACACATCTGAATGTTGATCAGCCGGCTTTCGAACCACTACAGAACAGATCGGAGAAAGCCCACGAAG
TACGGGTACGGCACCTGGGGTACCTCGCTTGAGAGTCTCAAATCGCGTCTTTCACCTCTTCATCTGTTCGCACCGAACTACCGCACGATGCCTGGCTCAC
GGCCCGCAAGTTATCTTTCAGGCTCCTGCATCACTCTGACAATAGCTCGTAGCACTCCTTTTCGGTTCCCACTTTCGCTTTTGCTCTCCGCACTTAGAAG
ACGTCCCAGTATTTCGCCATGATGCTCGCAGCTTCAGTGTTGTCCTGTGTGCTGCTCGCTGTTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGG
TTGATGCTGCCACGACGCTTACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTGGGCCAACGTCTTCGGAGATCGCGACGACATTGCTGACCT
ACTTTTCACTTTAAAGGAGACGGTGACGTTGAACGGCTCGACTACCGGCCTTCCGGCTTTGGGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCC
AGTAACGTCGTTGACGACAGTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCGGCATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGA
GCGATGACCCAACAAGCACGAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGGTTGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGC
CTTCTCGAATTCGCCGCCGTGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGATGGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAG
TTCGCACTGTACTTGGCCACTGTCGTTAGTCATGCCAAGACTA