Description :
From Genome Similarity Track
Location :
contig_47:340865- 342853
Transcript NameFunction/comments
g9705.t1hypothetical protein

Sequence
1988 bases(100 bases per row)
GGCGGATCAGTATATGCTGCCACGGAGAGCGCTCGGCTCTCGACTATTTCATCGCAAGAATACAGCAGCTCCAACGGCACCAGTATCCCTGACTGGCTCA
CTGTCGCTGAAGAGGGATTCTAAGTCGAAAGTGACTTTTGCAGCGAGTATGTGCCAGTGACGGAGTACGTGCGAGGATTTGAATGGTTAGTGTATTTCCT
ATTGCCGAAATTGTTGAGCTATGAAGTGATTAACAAACCTTCGTCAGCATGTATGGCACCATGGCTTCGTAAGCGAGACGGCTTTAATGTAGCATTTTAG
CCGTCCGACTTACTTACTCGTTCGCATTCCGAGTGGCTTGCCAGTGTCGTCCCATGGTGCCTTCATGCCAAGATCAGGCATGTTTTTGAGATTGGTAGTC
GCGGCTCCACTAGGCCGCTTCAACGGAGCGACGTGATGTGGCAGTGCTGACTTGCGTGGTTGCATCTCTCTCGCCACCTTTGCGTCTGCGTCTGCCGACG
ATTTCACACCTTCCTCGCGTCGGTGTTCCTCCTTGGAATCGGCTCGGAGTTGACTCTTGGTGCGTGATGTGATACAGTCGACTGCTGCGGCATCTTCCTC
CTCGTCTTCGTCAACAAAATCGTTGTCGACCTTCCACAGACTGATGCGGCGTAGCTCTTCACAGCCACGCACTCCATTGCGATACGTCTTGAGCTGGATA
CCTTCCTTCTGAAGAGAGACGTCTGGGAAATTGGTGTCAAGTAGCGGCTGCTCTTCCTCGCCATTTTCAAGGTAGACGTAGAAAGTGTAGTCATAGTATA
GCAGCACAAGCACGACGCCTCCAATGTGGATCTTGCTCGCAATAGCCTCCACATCCTATGCAGATCAAGCCCAGCAACGTTGAGTGAGTCGTGCAGTTAA
TGAAGCATGACACTACCAAAGTGAACTGACCTGGAATGCAGCGCATTTGCCCATGGCAATTTCAAAGAAGCACTCAACATTATCATCCTCAAGCCAGCTT
CCAACGTTGCCCGGGCTCTTGACGAACGACCCCCCAGTTTGAGCCAGTGTTTGCACGAATTGCTCTGCCTTGGACATCTCTTCCTGCATGGCAGGCACAA
TTCCTGCCAAGTGTTCCATCGACGGGGTAAATAATGATGTCGCTGGCATCTTGGAGACTTCGCACATAAAGGTCTACGAAAAGCAAAATTGACACACGAT
GAGTAACACCGCGAGCAGAATGAAACTTGACCACTCGAACATTACCAGAGCACTTTGCTGTCGTCGAAGCATGGGGATGATGATAGGAATGTCTGACAAC
TCAAGCTTTGGTCCCAGATCCACGTGCCCGTTGTAGCACCAGTTGCCAAATCGGAAGAGCACCTCGCGCAAACTCGGGGTGTTTGTGGAGCCTTCAGCAC
GAGGGGTGCGCCGAATGAGGAAGGTCTGGTTGTAACCTGTGCCACTGACATCTTTGCATTGCACTTTCAGTGGCTTCGGTGGGCTTTTGTGTTTTCCGAT
ACTAGCCGCCTGCCACAGCGTGAGCTTTTTCATGTTGCTGCAGTCGTCCTCACGGTATGTCTGCAAGTGGATGCCCTGAAGGTGAGCCGAGAGGTCCGGG
AAACGCACATCGAGCAGAGGCTGCTCGCCGTCTGCTTCCTGCAGCACGACGTAGAAACTACGTTGGTAGTAGATTACCAAGAGCACCAACCCACGCACAA
AGGTCTTGCTGGCCACGATGTCCACATCATCGAAGCATTCATAGCCACCGCTCTGCAACTCGAAAAAGGTCCTCGATCCACCATCGTCCAAATCGCCGTC
CACCCACGTGTGCTCCTCTGCAGCTTTCATCAGCTTGCGTTCAATACGCTCGCTTGAAAGCTCAGCGCCGATGAAGTCGTAGACATCGTACAGCGTTTCA
AGAGGTGTCGAGTATTGAGACGTTGAGGGCATGGCCTTCCACTCGCAAATATATTGTAGCGAAGCTTGCTGCTTCTGTAGGGCAGGTA