Description :
From Genome Similarity Track
Location :
contig_47:340815- 342803
Transcript NameFunction/comments
g9252.t1GAY03874.1 Hypothetical protein PINS_011706 [Pythium insidiosum

Sequence
1988 bases(100 bases per row)
GGCTGCTGTTGACCGAGCGCAGCTCGTTCAGACATACTTCCCGCGGAACATGCTTGCCTGGGTTGGCGGATCAGTATATGCTGCCACGGAGAGCGCTCGG
CTCTCGACTATTTCATCGCAAGAATACAGCAGCTCCAACGGCACCAGTATCCCTGACTGGCTCACTGTCGCTGAAGAGGGATTCTAAGTCGAAAGTGACT
TTTGCAGCGAGTATGTGCCAGTGACGGAGTACGTGCGAGGATTTGAATGGTTAGTGTATTTCCTATTGCCGAAATTGTTGAGCTATGAAGTGATTAACAA
ACCTTCGTCAGCATGTATGGCACCATGGCTTCGTAAGCGAGACGGCTTTAATGTAGCATTTTAGCCGTCCGACTTACTTACTCGTTCGCATTCCGAGTGG
CTTGCCAGTGTCGTCCCATGGTGCCTTCATGCCAAGATCAGGCATGTTTTTGAGATTGGTAGTCGCGGCTCCACTAGGCCGCTTCAACGGAGCGACGTGA
TGTGGCAGTGCTGACTTGCGTGGTTGCATCTCTCTCGCCACCTTTGCGTCTGCGTCTGCCGACAATTTCACACCTTCCTCGCGTCGGTGTTCCTCCTTGG
AATCGGCTCGGAGTTGACTCTTGGTGCGTGATGTGATACAGTCGACTGCTGCGGCATCTTCCTCCTCGTCTTCGTCAACAAAATCGTTGTCGACCTTCCA
CAGACTGATGCGGCGTAGCTCTTCACAGCCACGCACTCCATTGCGATACGTCTTGAGCTGGATACCTTCCTTCTGAAGAGAGACGTCTGGGAAATTGGTG
TCAAGTAGCGGCTGCTCTTCCTCGCCATTTTCAAGGTAGACGTAGAAAGTGTAGTCATAGTATAGCAGCACAAGCACGACGCCTCCAATGTGGATCTTGC
TCGCAATAGCCTCCACATCCTATGCAGATCAAGCCCAGCAACGTTGAATGAGTCGTGCAGTTAATGAAGCATGACACTACCAAAGTGAACTGACCTGGAA
TGCAGCGCATTTGCCCATGGCAATTTCAAAGAAGCACTCAACATTATCATCCTCAAGCCAGCTTCCAACGTTGCCCGGGCTCTTGACGAACGACCCCCCA
GTTTGAGCCAGTGTTTGCACGAATTGCTCTGCCTTGGACATCTCTTCCTGCATGGCAGGCACAATTCCTGCCAAGTGTTCCATCGACGGGGTAAATAATG
ATGTCGCTGGCATCTTGGAGACTTCGCACATAAAGGTCTACGAAAAGCAAAATTGACACACGATGAGTAACACCGCGAGCAGAATGAAACTTGACCACTC
GAACATTACCAGAGCACTTTGCTGTCGTCGAAGCATGGGGATGATGATAGGAATGTCTGACAACTCAAGCTTTGGTCCCAGATCCACGTGCCCGTTGTAG
CACCAGTTGCCAAATCGGAAGAGCACCTCGCGCAAACTCGGGGTGTTTGTGGAGCCTTCAGCACGAGGGGTGCGCCGAATGAGGAAGGTCTGGTTGTAAC
CTGTGCCACTGACATCTTTGCATTGCACTTTCAGTGGCTTCGGTGGGCTTTTGTGTTTTCCGATACTAGCCGCCTGCCACAGCGTGAGCTTTTTCATGTT
GCTGCAGTCGTCCTCACGGTATGTCTGCAAGTGGATGCCCTGAAGGTGAGCCGAGAGGTCCGGGAAACGCACATCGAGCAGAGGCTGCTCGCCGTCTGCT
TCCTGCAGCACGACGTAGAAACTACGTTGGTAGTAGATTACCAAGAGCACCAACCCACGCACAAAGGTCTTGCTGGCCACGATGTCCACATCATCGAAGC
ATTCATAGCCACCGCTCTGCAACTCGAAAAAGGTCCTCGATCCACCATCGTCCAAATCGCCGTCCACCCACGTGTGCTCCTCTGCAGCTTTCATCAGCTT
GCGTTCAATACGCTCGCTTGAAAGCTCAGCGCCGATGAAGTCGTAGACATCGTACAGCGTTTCAAGAGGTGTCGAGTATTGAGACGTT