Description :
From Genome Similarity Track
Location :
Scaffold_8:34081- 36814
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_8-snap-gene-0.44Vacuolar protein sorting-associated protein

Sequence
2733 bases(100 bases per row)
TCCGCGAGTAACGTCAAGATCAGTAATCAGGCGTTGTTCAACAGGAGACATAGCCGTCGATCTCTTTGCGTCGCCATCTTTTGCAGAGTCTGCAATACTT
TCTTTTCGCTCTGACTTTAATCCCACACTTCGCGATTGTTCCTCTCGATCGGGCAACAAATTTGCTCGAAGCATACTGTCTTCGGCACGAGTGTCGGAGA
AGTCTCGAAAGCCATCCATGTAAGCATGGTTTCCGGTGGTAGACGCGGTAACGAGCATTCTTGGTTTATAATGAAGCTGCAAGTGGTACATTCTTCTCTT
CGCCGCCATGTACGCCTCCATTCCAAAATGCTCTAGGCGCAGCAAGGTTCGCGGTAGCACGTTGAATCGAGCGGAAGCTAAACAGACGACCAGTGAGTTG
GCCGCGTTGGAGTTCTCGTTGTCTGGTTCTTGTGATGTGTTCAGCCTAACGATAAGCTGCGGGTCGTCTGGGTTCGATGTCGCATCTTCGACGGCATCCC
CCAGTGATAAACTTTGCCTTAAGCGCAAGTCAAAACTGTTTGGTCTGTCTTGGGCATGACTTTCGCTTGACATAGACTGACGGTATACTGTCCCCACTCC
GTTACTTGGTTTTCTCAGGTGGTTTGCTGCTCCAAATAGGTCAACAATAAATTCCTGTAGACACATTGCACACACAATTTAGTATTTCAACACGGCCGAG
CACATCAATGACTAATGCAGCACGTACCTCCGGATCAGCCATTTTGTCGCGAATAGTTGCTTGCTGCAACGAAAACTCGTACTTCGCAGGAAAAGTGTGC
ATTCCCGATTGAACTTCAAAGGACTTGATGTTCGCCTTCACTTGCATTCCTACTGCAGCAATCTCAGCGATAATGGTAGAATCAGGAACTCGATGCGAAA
TGCTTCTTTTTCCCCCTTCGTCATGGCGCTGTCTTCGAGGAGAGCCTGGATGTCCATTCCCGAACGCCGTGCCTGCATCACGCGAATGTGCTTCCTCGCT
CGCGTCGACTGCATTTTTCATCCATACCTCAAATTGCTGAGGCGCTTCGGAATATGCCAGCAAAACCAACTTGATCTCTTCGAGTACGATGACTGCAGTC
ATACCCCCACGTCGGACCTGCGCCGTATCGCTAGCGCCTTGAACCTCTTCGTGAATGGAAAAGTCCTCTTTTATTGTCACCGAACCTAAAAGAGAATCGG
CATCATCACGATCTCTTTTGTGACCCACCACTTTGGCAATATCCAAGATCGGCTTAATCGTTCCGTAGAAGACATCTAAGCCCAAACATATCGTCTTATC
GCCAACATTGAAGCAAACAGGCGATACCGTGACAGAAACATTCGTTCCTGGGCTTTCAGGAGCACCAGAGAGGACTTCGGCAAATTCGCCGCTCGCTGTA
CTTTCTGCCGGAGCAAGATGCGTGGGGAGTTCAATGTGCACGCGAATGCCAGTCTTCTCGAGAACAGTAATCTGCTGCTCATGAACGAACTTTATCTCCA
TTCCACTCACTGCAAGATTCACGTCACTTCCAGCCCAACTGCGCGTCACGCCTTCTTTCGCACCAAACAGTTTGGGTTCAATAGTTCCAAGTAAAGTGCC
AAGATCAATTCGCAGCCCGCCTGCCACAGGAGAGTCAGCTTGCGTGAAAGGAAGCACAATGCTGGCATTAAGGACCTTCAGCTCAATATCGAATTCGCCC
AGAACGCTCGTTTGCTGTGTCGACCTTTCTTTCTCTTGGACGTTTTCATTCGATCCTTCGACCGCGGGAATTTCGACTTTAAGTTGCCTTTCCGGAGGAG
ACGATCTTGAATTGGTCTTTTCTGCACGCTTGTTTGACGTGCCTATAGCATCGAAAAATGGAGTCAATCTTTCCAGTTGAGGGCTCATAAAGCCAGAGTT
TGGTGGTGGGGATAGCAACAGAGCGTCGTGGAACGAAGAATTTTCGAGAGCGAACGATTGCGAACGCGGATGGCGTCCAGAGCTTGACCATTTTGCATGC
AGTCCATGAGCATCGCCTCTTGTCAGCAGATACATTCGAAGGGGGCCGTCAAGGATGTAGCTTGTCATGTTCTCAACGAAGTCTGGCTGGACAACTAGTT
GAACGGGCTGGATAGTAATGCTTAGCTTGGACTTCTGTTCTCCCCTCAGTTTCGGTTCACTAGACACACCGTCACAGGCATCTTCGCCAAGCTCGACCTT
GTTCGCAACTCTACACTCAAGTCCTGCAATGTAATGAGGAGTACCGTTCGACGTGATATCCAGTCCGAAAATGTTCGTGTACTCGTTTCGGCTTGCGTCA
TGGTCGTTTGATCCATGAGTAAACCCGTCGCTTTGGCCGTCGGTCGTACTCTTCTTGGAGTTCAAGTCAAACAGTTTCACATCACCAATCGTCCCCTTCA
CGACCAGATCACCTTCATCAGTTGTATTCACCAAGGCATGCAAACGGAGAACTGCCACCGACGCTTCAGGTTCGCCACGGTCACCAAAGCAAACGGACAT
TGACTGAAATCGAGCAGTCAGCTTCAGCATAACGGGTTTTCGACGTTGCGCGCTTTCACCGCTTCTCAGATTCTTTGACTCGGAGTCGTTCTGCTCCTTC
AGGAACACTTTGCGGGCCTTTTCCAGATCTGCACGAACAGACTCAGTAAGACTCATCGGTAGCGAATATTCCTGATGAATTGAGGGAGTAAGCTCGAGAG
GCGGCAAGATGTCGTCGATTTCATCCTGTGGCG