Description :
From Genome Similarity Track
Location :
Scaffold_416:3408- 5239
Transcript NameFunction/comments
Aphas_H257_19242Hypothetical protein

Sequence
1831 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCATCACATACACAACCGGCGTACAAAGAAGAT
CCGACTTTCTGGACACCCTTCAGTCTGCTCCAGTTATCTTGTTCATTGTCATAATCAGTAACGAGTAAGAGCTTGTTGCTCAGACGTACCGCTCGGAAGG
GTCGCAGGTTCTTCCACAGGTAAGGCTGTCCTTCGCCATCGTCATCACTTGGGCGACGCACGTCGACCAGGCACGCCGTAAGGAGTTGTCGTCTGCACAC
TAATGACACTTCCACCACTTGAATTTCGCGGTATCATGCACAACAGCACGTACTGTACGAAGGACGGTGCTGAAGGACCAAATCAATGAAGCAGCGCATG
CTCTCCATGGCTGGGGCTCAAAGACTGGAAAGGTACAAGACGCACGCCCCGCCCCGGTGATATCGTCGGTCGTCATCATCACCACCGGGGAGGGACAAGT
CGCACGCCGCCGCCGCTCGACATGGTCACAGATCCACTAATCACATATCATCACCATCAATCTCACACACACATTCACAAACATGCATTCGTACGCTTGA
AATAAATGCACCCCGCCCCGGTGATATCGTCGGTCGTCATCATCACCACCGGGGAGGGACAATTCGCACGCCGCCGCCGCTCGACATGGCCGCAGATCCA
CTAATCGCATAACATCGCCATCAATCACACACATATTCAAGAACATACCACTGTATATACGCATTCTATCCAAGCTGCATGTAATATACATGCACATGGT
CGGTCCTCCCCGATGTCATCCCTCAGTTGCCCCACCATGTGCATAGCATAGCGCGAGGCGAAACGCGATGGATGGCAACGGGCGTTCATTTCCCGAGGCC
GCTTGTTTTGTTGCTATCACACATTGAATGAAAAAACGTGTTTGTGGATGGAAACATGTAATAAATACCTGTGTTGTTTGTGTCCACGAGCGTTCATCTC
TCGTGGACATTGGTGGACTCCAGGTTCTACCTCCTGTGCCCTCCGTACACCTCTTCAACTGCACCGCTCGTGACATCAACGACAGTATCGTGTGCAAGGC
GACGAGACAGTTCGCGGTCCTCGTGACTTGAGCAGATGAGCAAGCGTCCGAGGCGCACAGGCTTCTCTCCCCAGGGCGGCAGAACCAGAGTCGATGCTTG
CAACCTCGCAAAAGTATATCCGGAACATAAGTTTCATTGGACGGTTTGTTTCATTTATCCGGACTGAAATTTCGTGTCTTTACACCCACATTATCTATGA
ATGACCTCAACACGGTTGGACCATTTATGCTATGGTCAGGTAATATATAAGTTTATAAAGTTATGTATTTCAAGAATATTTGGTGGGACAGTTCCAACAC
ATGGTCCGGATAACCTGTTCCAATCGTTTCATTTTAAGACTGCCTGTGATGCGCATAGCATGGCATCTGCGCGCGTGAAAGTATGGGGTAACGATAATGC
TTGGGTACAGTTAGATGGGGAATACGGTAGGTCTGTGTCGTCTTCGACACCTGTGATTACCCTAACAAGCACCCACACTATCCATGATACTAGTAAGCAT
TTAGCAATTTTAGGTTATCTGCGGGGCAGGGCAAGGAACTTACCCATTTTCAAGTCGAATGTCCGGATGATTCGGCATGGTTACCGTGTGTAATGTATCG
AGTTCATTCAGTATACTAGTAATCTATTGGA