Description :
From Genome Similarity Track
Location :
contig_114:3408- 4855
Transcript NameFunction/comments
g13380.t1XP_009525761.1 hypothetical protein PHYSODRAFT_247933 [Phytophthora sojae

Sequence
1447 bases(100 bases per row)
GGGTACGCTGGTGCGAGCTGGCCGTGGGAGAGCTGTGGTGGTCGGTACAGGCTCCCGCACCGAATTCGGACAAGTCTTTGATGTTGTGCACAAGGTGGAG
GAACGCAAGACGCCGCTGCAGAACAGCATGGACACGTTGGGCAAGCATCTCAGCATGTTCTCGCTTAGTGTGATCGCAGTGATCGTGGTCATTGGAGTGA
TCCAACACAAGGCATGCTCACCATGCTGCAAATTGGCGTCTCGCTGGCTGTGGCGGCCATCCCTGAGGGCCTACCAATATGTGTGACTGTTACGCTCGCA
TTCGGTGTGATGAAGATGGCCAAGCGCCATGCCATCGTGAAAAAGCTGCCTGCCGTCGAGGCGCTGGGATGCATCAACGTGGTCTGTGTGGACAAGACTG
GCACGATCACGACGAACAAGATGGAGGTGATCGAGATTTTCGTTCCGTTTGAAACTGTGACCGCTGAGGTGAACGGTATTGGCGAGCGAGTGCGTTCTCC
ATCACAGACGCTAGATATGCCCAAGAAGAGCGCGCGTTCGGCTGTGACTATGCGTGGTGAACCCGTTACCGAGGAATCCCACCCCCATGTTTATCACTGC
CTCCTATCCGGTGCGCTGTGCAACAACGCGACTATCGTGGACCGAGAAGTTTTGGGCCAAGCTACGGAGGGTGCTGTTTTGTTGTGTGCGCAGAAGGTGG
GGATTACCCCATCGGTCATTCAGCAATTCCGCCGTGTTAGCGAAGTTCCCTTTAGCTCGGAAAAGAAATGGATGGCAGTGTGCTGTGAGCCACCGATGGG
GGGCCCTTCTCGCTGGTACCTGAAGGGTATGACGGAAGCTATCTTGTCACGCTGCGATAAGATTGAGGATAATTGCGGCCGCGAAAAGGAAATGACCCCA
GGAGACCGTGAACGCATTTTTGTGGCGTCCCAGCAAATGGCGGCACGTGGACTTCGTGTGTTGGCATTATCGTTCGGTGAGCACTCAGATCGTGGTATGG
TCTTCGCTGGACTTGTGGGAATCTCAGATCCGCCTCGTGCTGAAGTTGAGAAGTCTGTGTTGGAGCTTTCTCTGAGCGGGGTCAAGACTGTTATGCTCAC
GGGGGACTCCAAAGAGACGGCCATTGCAATTGCCACCAAGGTGGGCATCATTTCAAACGACCATTTCGGCAGCGTAGAGTGCGACGACGAGAGAATCAAG
GCCGTGGACGAACTAGTAATTTCTGGCCAGGAGCTTGAGATCATGGAGATGATGGAGTTGGAGCAACGCATTCTGAAGACATGTGTGTTTTACCGTACGT
CCCCGCGCCACAAACTGAAGATCGTGCGGGCTTTCCAAGAGGCAGGACTGATGGTAGCCATGACTGGTGACGGTGTGAACGATGCACCCGCTCTGAAGGC
GGCAGATATTGGCATTGCAATGGGCACAAGTGGCACGGATGTTTCGA