Description :
From Genome Similarity Track
Location :
Scaffold_1472:3408- 4521
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1472-fgenesh-gene-0.1Ran-binding protein (RanBPM)

Sequence
1113 bases(100 bases per row)
CACCGCAAGAAGAGACGCCCAACGGCCGGCCCATTTCTCTCGCGCCCTCTCGCTCCTGCCGCCGAAACCCCTCACATCCATTTCTCCAAGGCTCGCGCTC
CTCTCCCCGGAATAAGAATGGTCGCCACGGCAATGAACGCGCCGAGCTACTCGCCCAACCAGCACAAGCTGCGCACCTATATCGTGCTCAACGCCAAGTC
GTCGCGCGGCCGCCTCGCGAGCTTTACCGACTCGCTCGACGAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGCCGTCCTCG
TCCCCCGCGACGTCGCCGCTTCGCGCCACGCGCAAGTCGCTGGCCGCCGTGCACGCGGAGCCGCTCATCCCGGACGAGTGTCTCGCCTACGAGAGCTACG
CCGCCGTCGCGTCCCGCTCGCAGACGTCCACGTCGCCCACGCGCGACCTCCGCTGGAGTGACATCTCGCGCCCCCGGCTTCACCTCACGACACTGACTAC
CAATGTCACTAAGACCCATCACGGCAAGCCGCTGAGCCAGAAGGAACGCCGCCGCCAGCTCCAGCGCGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCAACGACCACTTGGAGTGCCACGCGCTCGAGCTCTGCTTCGAGTTTCTCAGCCTCGCCGATCTCCAGCGCGCGACCGCCGTGTGCAA
GGAATTCCGCGACGTGGTCCACAGCGCAGGCCGGCTTTTCGTCGCGCTCTACGCGCGCACGTGGCGCACGGGCTTGGCCACGCCCACGCCGCGCATGCCG
CGCGCCTACGCGCAGCTGGGCTTTTCGCCGGCGCTCCAGATGGTGCAGCAGCGCCGCGCCGACTTTGACTACCCGCTCACGACGCGCAGCCACGTGACCA
AGCGCGCCGACGCGACGTACGAGATCCTCAACAACTCGCTCTTGCGCGTGCTCACGCGCGGCGCTGTCGACTCGGCGCGTGGCGTGAAGGCGCTGCCCGT
GCAGCCCTGTGCGCAGGCGCTCGGGGTGGACGTGCGCTACTTCGAAGTGGCCATGAGCGGCTGCGGCAGCGTCGGCGTCGTGTCGCTCTCGGACGTCAAG
ACCCGCCTGTCGT