Description :
From Genome Similarity Track
Location :
Scaffold_222:34071- 35205
Transcript NameFunction/comments
Phyke_g6955hypothetical protein

Sequence
1134 bases(100 bases per row)
AAATTAACAAGTGCGTCGGTATACAGGGTTCCAATCAAATGAAAGTGGAGCGTGGTAAAGTGTACGCTGGGCTAAAGTATCACGCAAGTACTTCGGTCCG
AATGGAGTACTTTGAGAAATTTGGGGTTAAGCCAGGCTCGAAGCAGAGAAAGAAAAAGGTAGGTCGGATATTCGTCTGCTGTAGAGctgcgcttcagcaa
ctcaCAAGAAATTATTATGGCAGCTGGCGGCGCTTGTGTGGACTAGCTTCGAAACAGCGGACATCAGCGCAGAGGTATGTTGATCATGAAGCGTTGATTG
TTGAACGCTTGCTGTGGTGCTTACGCACACGAGTTTTTGTGCCTCCAGGTTGTTATTACCAGTTCTGCCATTTCTGAAGAGGGTAGCCTAATCTCCGCTC
AAATCGAACATCAGAAAGAGGTATGGAATTGTGCTGAACTACCTTTAAAACTGCTGAAATCTCATTGAGCAACGATTGTGTGGTTAAAACGTGTAGCGCC
GACTTCGTGACAACTTGGCATTTACGGTGAACGCTGCACTCAAGTCAATCCGAGCCTCAACTACACACGTCCCAAGGATTGTATCCCCCCCTCCCTCCGT
CACAGATCGCAGCCTCGTTGAATTGCAGCACCAGGTGCGCATGCTCTCGTTGCAAAACCGGCAGCTCGCTGATGATCTTGCGGCATCAAAGCAAATGACA
AGTAAGTTACGCATGGAAATTCAAAGAGCACAACAGCCCCAGCAATTGCAGAGGGCTCTCTCCAATAGCACTTAGAGATCCAATAGCATGGAGAGCAACT
CGGTTTGCAAGATCAATAATTGGTTTTAcaagatgttgaagttgaagcaaTAGCCTATCTTGCAGCATATGATGAAAAATGCTATTTAGTGGGTGGATTA
GTGGGTTTCTTGGCTGATCTTCCACTTTGCATCTCTCCAAGCTGAAGCAAGATGTCGCCTCTCTACGCTCTAGACGATGCAATATTAGCACACGTGCTCA
GCTTCTCGACAGCACGGGACGTGGAGGCTATGACCACAGCTTCCAAATTCGTTGcactgcagttgctgccgcagcacCCTGAGATCTGGCGCATGCTGTT
CGTGCACCGTTGGGAACAAGTCAATTTCCCGTTG