Description :
From Genome Similarity Track
Location :
Scaffold_2097:3407- 4885
Transcript NameFunction/comments
Phypl_g14665hypothetical protein

Sequence
1478 bases(100 bases per row)
GCTCTgggggcatttatataggtttcattataggtgtctggtagtttgtattgcaggccaaaGTACAGCCCTATAAATATATTCCAGGCTTAAAGCTACC
TTATCtttggtaccagtccccttcaggccagggaccAAGTGAACtgtcgttcactgggagtttgtaaAAACTCCGAAGTACACgcttcctctgtgcaacg
tgcttgtgtgacagcccgtcacactTGGGAGCACTTGTTGTCAATCCGACACCTACGCGGGTGGATTGGACTACCTGAATCCTCTGTGGTCTCTAAGAAA
GAGAGTCACCATGGATTGAGGAGAGTTTCCTCATTTGACTAACGCTCAGTTTGAATCGGTCCAGAAGATGGCGGCCATATTTGGGATGGATGCCTTCCGA
AGCttggcagcggcaccaccgcccgagcaggtcgagcgcgTGAATGCGTTTGACACCTACGAGGGTTGGCTCATCGCTCACGTGCAGAGTTTACAGCCTC
CTCAGGCTGCGCCGAGGCCGGCCCAGCCTTGAGGCTGAAGGTCCAAGtctacgacgagaaggaaggTGAGAACCTTCACTTCTGGGTCCGAGAGGCTGTG
CTCGCGATGGACGCGGCCCTACTCTCGGACGAGCGACTTCGTGTTGCTTTTGCGCTCTCGCATCTCGGCGGTCGAGCCAAGAGCTGGGCTTACACGCGTG
AAGCGACGTCGCCTGGATATTTCACAACCTGGGCCCAGCTGTGTGAACAGCTGCGAGCCGCCTTCCTCCCGGCGAACTGGGAGTATCACCAGTGCTCACG
CTTCCTTGGCTGCAAGCAATGGAAacgtgagctgcacgagttcATCCAAGAGATGCGCGAGCTAACGGAATCTCTGGTGGGGAACCCCCTACCTGAACAC
ATCAAGGTCATGGACGGGCTCTGTGTGAGCCCTGCTCGCACGCAGCTATTGCGCGTGCAAGTCAGCACCCTGAAAGAGGCGATCCAGATCGCCCGTCAGG
AAAAGTACAGCTACAAGCAAACTCGTACTCCCACCACGGCGTGGAATGGCTACGCAGGCCCGAGCAATAGCTCCGCCAGGGGTGCTCCCAATGGTCCAGT
GCCGATGGACCTCAGATTGGCCGATAATAGCAGTATTCGCTGCTatggctgcagcaagctaGGGCACATTAAATGTGCCTGTCCTGCGGGACAAGGGAGG
ACTAACTCTTCCAAGCCCTTTGCTCTGAAGGGTCGCTGGCAGAAGCCGCGACCAGGGGACCAGGGAAACGCAGGACACCAGTAGGGACGGGGGGCCCTAC
TGGGGAAGACCTAAGTCTTCATGAACGGTGCGCGGGTGGCGCGCACCATGAAGGCTTAGCCTCTGATAGTCTATGCACTCTCGAACAGAAGAACGGCAAC
GGTGGGCTGCTAGTAGTACACGCACGTGTACGGGGATACGATCATCCCTTCCGAGTTTTGATCGACTCTGGGGCGTCG